Primer set and method for multiple nested fluorescent quantitative PCR detection of transgenic soybean gts40-3-2 and exogenous genes

A genetically modified soybean and fluorescent quantitative technology, which is applied in biochemical equipment and methods, microbial measurement/inspection, recombinant DNA technology, etc., can solve the problems of low detection throughput and unstable reaction, and achieve the effect of high sensitivity

Active Publication Date: 2016-05-25
JINAN UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above PCR-based methods all have their own advantages and disadvantages. For example, although multiplex PCR improves the throughput of detection, the system contains many pairs of primers and the reaction is unstable; fluorescent quantitative PCR has quantitative ability, but due to the probes Detection throughput is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer set and method for multiple nested fluorescent quantitative PCR detection of transgenic soybean gts40-3-2 and exogenous genes
  • Primer set and method for multiple nested fluorescent quantitative PCR detection of transgenic soybean gts40-3-2 and exogenous genes
  • Primer set and method for multiple nested fluorescent quantitative PCR detection of transgenic soybean gts40-3-2 and exogenous genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] (1) Extraction of DNA

[0061] The DNA of the transgenic soybean GTS40-3-2 sample (purchased from Shantou Entry-Exit Inspection and Quarantine Bureau) was extracted by kit method (Wizard Genomic DNA purification kit, A1120, Promega).

[0062] (2) Multiple nested fluorescent quantitative PCR

[0063] First round of multiplex PCR. The reaction system contains 25 μL of A solution, 0.25 μL of DNA polymerase, 10.5 μL of primer solution, 50 ng of sample DNA to be tested, and ddH 2 O to make up to 50 μL. The first round of multiplex PCR reaction conditions: 94°C for 5min; 94°C for 30s, 60°C for 30s, 72°C for 90s, 15 cycles; 72°C for 5min; the specific number of cycles can be adjusted within the range according to the actual situation. After the first round of multiplex PCR reactions, ddH 2 O dilute the PCR product 100 times;

[0064] The second round of fluorescent quantitative PCR. The reaction system contains 12.5 μL of solution B, 0.2 μL of DNA polymerase, primer solu...

Embodiment 2

[0067] Using the identification method of Example 1, the isolated and purified transgenic soybean GTS40-3-2, A2704-12 (purchased from Shantou Entry-Exit Inspection and Quarantine Bureau), transgenic corn Bt11, T25 (purchased from Shantou Entry-Exit Inspection and Quarantine Bureau), Transgenic rapeseed RT73 (purchased from Shantou Entry-Exit Inspection and Quarantine Bureau) and non-transgenic soybean (Hefeng 25, purchased from Soybean Research Institute of Northeast Agricultural University) were identified.

[0068] The results are shown in Table 1, which shows that only the soybean endogenous gene lectin is positive in non-transgenic soybeans; all five genes of transgenic soybean GTS40-3-2 are positive; transgenic soybean A2704-12 has soybean endogenous gene lectin and CaMV35S promoter These two genes are positive; transgenic maize T25 has a gene of CaMV35S promoter which is positive; transgenic Bt11 has two genes of NOS terminator and CaMV35S promoter which are positive; tra...

Embodiment 3

[0072] GTS40-3-2 genetically modified soybeans and non-transgenic soybeans (Hefeng 25, purchased from the Soybean Research Institute of Northeast Agricultural University) were used to prepare samples with GM contents of 100%, 10%, 1%, 0.1%, and 0.01% according to the mass ratio. , using the identification method of Example 1 to analyze the NOS terminator gene. Also refer to the primers and probes of the NOS terminator gene in SN / T1204-2003:

[0073] Upstream primer: ATCGTTCAAACATTTGGCA (SEQ ID No: 21);

[0074] Downstream primer: ATTGCGGGACTCTAATCATA (SEQ ID No: 22);

[0075] Probe: FAM-CATCGCAAGACCGGCAACAGG-BHQ1 (SEQ ID No: 23); wherein, FAM is a fluorescent group, and BHQ1 is a quenching group.

[0076] The results show that ordinary fluorescent quantitative PCR can detect samples with a transgene content of 0.1%, while multiple nested fluorescent quantitative PCR can detect samples with a genetically modified quantitative PCR of 0.01%, which is higher than the common fluo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a transgenic soybean GTS40-3-2 and endogenous and exogenous gene multi-nested fluorescent quantitative PCR (polymerase chain reaction) detection primer combination method. Multiple PCR, nested PCR and fluorescent quantitative PCR are combined, primer design is strictly controlled, the detection process is improved, a multi-nested fluorescent quantitative PCR detection system is built and can quantitatively detect transgenic soybean GTS40-3-2 strains, common exogenous gene NOS (nitric oxide synthase) terminators, CP4-EPSPS, CaMV35S promoters and soybean endogenous genes Lectin, and sensitivity of the method is improved by one order of magnitude as compared with common fluorescent quantitative PCR. The method has the advantages of small template demand quantity, high sensitivity, high flux, strong specificity and the like, and can be applied to rapidly and quantitatively detecting trans-genes. A novel method is provided for rapidly, accurately and quantitatively detecting the trans-genes at high flux.

Description

technical field [0001] The invention belongs to the technical field of food quality and safety detection, in particular to a multiple nested fluorescent quantitative PCR detection kit and its application, in particular to a multiple nested fluorescent quantitative PCR detection primer for transgenic soybean GTS40-3-2 and endogenous genes Panels, kits and assays. Background technique [0002] With the mass planting and application of genetically modified crops, genetically modified products have begun to enter our lives in large numbers. It is very important for consumers to detect and label genetically modified crops and their products before it is determined whether they have potential adverse effects on human health and the ecological environment. my country's genetically modified food technology started relatively late, and the "Agricultural Genetically Modified Organism Labeling Management Measures" was implemented on March 20, 2002, requiring the labeling of 17 types o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6844C12Q1/6851C12Q1/686C12Q1/6895C12Q2600/124C12Q2600/16C12Q2561/101C12Q2537/143
Inventor吴希阳魏霜周广彪刘玉莉
OwnerJINAN UNIVERSITY