RGD-recombinatn staphylokinase-human alpha microglobulin fusion protein, and preparation method and application thereof

A technology of fusion protein and microglobulin, which is applied in the field of genetic engineering, can solve the problem of RGD-recombinant staphylokinase activity decline, and achieve the effect of maintaining thrombolytic activity, high-efficiency expression, and good anticoagulant activity

Inactive Publication Date: 2015-08-19
CHONGQING MEDICAL UNIVERSITY
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, the fusion protein of the present invention also overcomes the shortcomings of some existing RGD-recombinant staphylokinase activity decline and insoluble expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RGD-recombinatn staphylokinase-human alpha microglobulin fusion protein, and preparation method and application thereof
  • RGD-recombinatn staphylokinase-human alpha microglobulin fusion protein, and preparation method and application thereof
  • RGD-recombinatn staphylokinase-human alpha microglobulin fusion protein, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Expression and purification of embodiment 1 recombinant staphylokinase

[0065] For the expression and purification method of recombinant staphylokinase (rSAK), please refer to "Expression, Purification and Identification of Fibrinolytic Activity of Recombinant Staphylokinase", Journal of Chongqing Medical University, Vol. Cold, Zhou Jianzhong.

[0066] That is, the main construction methods are as follows:

[0067] Using gene synthesis technology, optimize the synthetic rSAK full-length gene sequence, while keeping the protein sequence unchanged, optimize part of the codon base sequence that may affect the translation and expression process, making it the preferred codon or the best codon for Escherichia coli Codon, using pET-28a as a vector, induced the optimized gene sequence to be expressed in competent E.coli BL21 and purified by Ni-NAT column.

[0068] The rSAK full-length gene sequence is shown in SEQ ID NO.1, specifically:

[0069] TCATTCTCCTCCATTACCAACGAAGTC...

Embodiment 2

[0072] Example 2 Expression and purification of human α-microglobulin fusion protein

[0073] For the expression and purification method of human α-microglobulin (α1M), see Zhang Y, Gao Z, Zhang Z, et al. Cloning, purification, crystallization and preliminary X-ray sstudies of human α1-microglobulin[J]. Acta Crystallogr Sect F Stryc Biol Cryst Commun, 2012, 68(pt 6):692-694.

[0074] The gene sequence of the human α-microglobulin (α1M) is shown in SEQ ID NO.3, specifically:

[0075]CAAGTGCAGGAAAACTTCAATATCTCTCGGATCTATGGGAAGTGGTACAACCTGGCCATCGGTTCCACCTGCCCCTGGCTGAAGAAGATCATGGACAGGATGACAGTGAGCACGCTGGTGCTGGGAGAGGGCGCTACAGAGGCGGAGATCAGCATGACCAGCACTCGTTGGCGGAAAGGTGTCTGTGAGGAGACGTCTGGAGCTTATGAGAAAACAGATACTGATGGGAAGTTTCTCTATCACAAATCCAAATGGAACATAACCATGGAGTCCTATGTGGTCCACACCAACTATGATGAGTATGCCATTTTCCTGACCAAGAAATTCAGCCGCCATCATGGACCCACCATTACTGCCAAGCTCTACGGGCGGGCGCCGCAGCTGAGGGAAACTCTCCTGCAGGACTTCAGAGTGGTTGCCCAGGGTGTGGGCATCCCTGAGGACTCCATCTTCACCATGGCTGACCGAGGTGAATGTGTCCCTGGGGAGCAGGAA。

[007...

Embodiment 3

[0078] Example 3 Plasmid construction of RGD-recombinant staphylokinase-human α-microglobulin fusion protein

[0079] 1.1 Materials

[0080] Recombinant staphylokinase (rSAK) was constructed by Example 1, human α-microglobulin truncation (α1M) was constructed by Example 2, and the plasmid vector PEGX6P-1 was purchased from Novagen. Escherichia coli DH5α, BL21, 3C protease, restriction endonuclease NotI, SalI, T4 DNA ligase, high-fidelity rTaq enzyme, dNTP, plasmid purification kit, DNA Marker, molecular weight protein marker, etc. were purchased from Takara Company. Plasmid extraction kits were purchased from Promega. Thrombin, plasminogen, fibrinogen, and urokinase standard products were all purchased from China Food and Drug Control Institute. The rest of the reagents were of domestic analytical grade.

[0081] 1.2 Instruments

[0082] Water bath box, incubator, metal bath connector, PCR instrument, gel imager, ultrasonic breaker, gradient cup, protein concentration dete...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides an RGD-recombinatn staphylokinase-human alpha microglobulin fusion protein, and a preparation method and an application thereof. The amino acid sequence of the RGD-recombinatn staphylokinase-human alpha microglobulin fusion protein is represented by SEQ ID NO.12. The preparation method of the fusion protein comprises the following steps: obtaining a target gene fusion fragment through adopting an overlap extension PCR technology; inserting the target gene fusion fragment into an expression vector to construct a recombinant expression plasmid; transforming the constructed recombinant expression plasmid into Escherichia coli, and allowing the recombinant expression plasmid to highly express in the Escherichia coli; and carrying out fusion protein separation and purification. Compared with present products of same kind, the fusion protein has the advantages of efficient thrombolysis and anti-coagulating activity and low immunogenicity. The fusion protein also can overcome the disadvantages of activity decrease and insoluble expression of some present RGD-recombinant staphylokinases.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to RGD-recombinant staphylokinase-human alpha microglobulin fusion protein and its preparation and application. Background technique [0002] Natural staphylokinase (staphylokinase, SAK) is an extracellular protein synthesized by lysogenic phage of Staphylococcus aureus. It consists of 136 amino acid residues and has a molecular weight of 15.5KD. Staphylokinase, endogenous tissue plasminogen activator (tPA) and urokinase (UK) are both third-generation thrombolytic preparations, and are the first-line drug for clinical thrombolytic therapy of myocardial infarction. The thrombolytic mechanism is different from the other two: it has no protease activity itself, and is an "indirect" plasminogen activator, which is produced by specifically combining with plasminogen (Flg) at a ratio of 1:1 The inactive SAK-Flg complex is further converted into an active SAK-Flm complex under...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/54C12N15/63A61K38/45A61K38/17A61K48/00A61P7/02
Inventor周建中汪德强苟冶然龙小滨陈检杨可白垒雷寒黄爱龙何泉张宏鹏
OwnerCHONGQING MEDICAL UNIVERSITY