Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of medicinal wild rice gene oobzip2 and its expression vector and construction method

A technology of medicinal wild rice and expression vectors, which is applied in the field of medicinal wild rice gene OobZIP2 and its expression vector and construction, and can solve problems such as inefficient use of favorable traits and reproductive barriers

Active Publication Date: 2018-12-28
SOUTH CHINA AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because of serious reproductive barriers between it and cultivated rice (AA genome), its beneficial traits have not been efficiently utilized at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of medicinal wild rice gene oobzip2 and its expression vector and construction method
  • A kind of medicinal wild rice gene oobzip2 and its expression vector and construction method
  • A kind of medicinal wild rice gene oobzip2 and its expression vector and construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Preparation of the medicinal wild rice gene OobZIP2 target gene

[0051] A medicinal wild rice gene OobZIP2 is prepared through the following steps:

[0052] 1) Extracting medicinal wild rice RNA;

[0053] 2) Synthesizing the first strand of cDNA: using the ZeroBack Fast Ligation Kit kit to synthesize the first strand of cDNA;

[0054] 3) PCR amplification: using the first strand of cDNA as a template, using the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3, perform PCR amplification to obtain the target gene band, electrophoresis cut rubber recycling;

[0055] SEQ ID No. 2: CCGTCAAATCAAGCACCCC

[0056] SEQ ID No. 3: TTGATATGAACACAGCGAGCC

[0057] Among them, PCR amplification reaction system: 10×PCR Buffer for KOD-Plus-Neo 5μL; 2mM dNTPs 5μL; 25mM MgSO 4 3 μL; upstream primer (10 μM) 1.5 μL, downstream primer (10 μM) 1.5 μL; template 5 μL; KOD-Plus-Neo (1U·μL-1) 1 μL; Autoclaved, distilled water 28 μL; wherein th...

Embodiment 2

[0061] Embodiment 2: Construction of prokaryotic expression vector of medicinal wild rice gene OobZIP2

[0062] A method for constructing a medicinal wild rice gene OobZIP2 prokaryotic expression vector, comprising the following steps:

[0063] a) PCR amplification: using the target gene recombinant plasmid obtained in Example 1 as a template, using upstream primers such as SEQ ID No.4 and downstream primers such as SEQ ID No.5 to perform PCR amplification, electrophoresis and gel cutting Recycle;

[0064] SEQ ID No. 4: C GAGCTC ATGGGGAATGATGAAGC;

[0065] SEQ ID No.5: ATTT GCGGCCGC CCTTGCGGCTACAGCATCAGTC;

[0066] b) double digestion: use Sac I and Not I to perform double digestion on the gel-cut recovery product obtained in step a), and obtain the enzyme-cut gene fragment after gel recovery;

[0067] c) Ligation: The plasmid pet32a(+) was double-digested with Sac I and Not I, after gel cutting and recovery, it was ligated with the enzyme-cut gene fragment obtained i...

Embodiment 3

[0072] Embodiment 3: the construction of medicinal wild rice gene OobZIP2 overexpression vector

[0073] A method for constructing a medicinal wild rice gene OobZIP2 expression vector, comprising the following steps:

[0074] a) PCR amplification: using the target gene recombinant plasmid obtained in Example 1 as a template, adopting upstream primers such as SEQ ID No.6 with Sma I and Xba I restriction sites and as shown in SEQ ID No.7 The downstream primers were used for PCR amplification and gel recovery by electrophoresis;

[0075] SEQ ID No. 6: TCC CCCGGG ATGGGGAATGATGAAGC;

[0076] SEQ ID No. 7: GC TCTAGA TTACCTTGCGGCTACAGCATCAGTC;

[0077] b) double enzyme digestion: use Sma I and Xba I to perform double enzyme digestion on the gel-cut recovery product obtained in step a), and obtain the enzyme-cut gene fragment after gel recovery;

[0078] c) Ligation: Plasmid pCAMBIA1301 was double digested with Sma I and Xba I, after gel cutting and recovery, ligated with the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a medicinal wild rice gene OobZIP2, and an expression vector and a construction method thereof. Particularly, the nucleotide sequence of the medicinal wild rice gene OobZIP2 is disclosed as SEQ ID No.1, and the amino acid sequence coded by the gene is disclosed as SEQ ID No.16. The wild rice gene OobZIP2 has the complete CDS region, and has obvious expression of up-regulated genes which belongs to Subgroup G of Group bZIP. The OobZIP2 has transcription activation activity. The OobZIP2 expression level in the transgenic plant obtained from the OobZIP2 is obviously enhanced, and the transgenic plant has salt tolerance and drought tolerance.

Description

technical field [0001] The invention relates to the field of rice genetic engineering, in particular to a medicinal wild rice gene OobZIP2, an expression vector and a construction method thereof. Background technique [0002] Rice is one of the most important food crops in the world, and it is also the largest food crop in my country. Abiotic stresses such as drought will seriously affect the growth and yield of rice. [0003] In the Oryza genus, only two Asian cultivated rice (O. sativa L.) and African cultivated rice (O. glaberrima Steud) are cultivated species, and the remaining 20 species are all wild rice. Growing, through resisting the invasion of diseases and insect pests and the natural selection of adverse environment, wild rice contains a large number of good genes, which is a natural gene treasure house (E Zhiguo et al., Genetics, 2008(11):1397-1405., 2008). However, because of serious reproductive barriers between it and cultivated rice (AA genome), its favorab...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/66C12N15/82C07K14/415A01H5/00A01H6/46
Inventor 陈志雄戴双凤刘向东谭碧兰谢海媚夏昌选
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com