Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A medicinal wild rice gene oobzip1 and its expression vector and construction method

A technology of medicinal wild rice and expression vectors, which is applied in the field of medicinal wild rice gene OobZIP1 and its expression vector and construction, and can solve problems such as reproductive barriers and ineffective utilization of favorable traits

Active Publication Date: 2018-12-28
SOUTH CHINA AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because of serious reproductive barriers between it and cultivated rice (AA genome), its beneficial traits have not been efficiently utilized at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A medicinal wild rice gene oobzip1 and its expression vector and construction method
  • A medicinal wild rice gene oobzip1 and its expression vector and construction method
  • A medicinal wild rice gene oobzip1 and its expression vector and construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1: Preparation of the medicinal wild rice gene OobZIP1 target gene

[0057] A medicinal wild rice gene OobZIP1 is prepared through the following steps:

[0058] 1) Extracting medicinal wild rice RNA;

[0059] 2) Synthesizing the first strand of cDNA: using the ZeroBack Fast Ligation Kit kit to synthesize the first strand of cDNA;

[0060] 3) PCR amplification: using the first strand of cDNA as a template, using the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3, perform PCR amplification to obtain the target gene band, electrophoresis cut rubber recycling;

[0061] Among them, PCR amplification reaction system: 10×PCRBuffer for KOD-Plus-Neo 5μL; 2mMdNTPs 5μL; 25mM MgSO 4 3 μL; upstream primer (10 μM) 1.5 μL, downstream primer (10 μM) 1.5 μL; template 5 μL; KOD-Plus-Neo (1U·μL-1) 1 μL; Autoclaved, distilled water 28 μL; Chain dilution 10 times;

[0062] The PCR reaction program is: after pre-denaturation at 95°C for 15...

Embodiment 2

[0065] Example 2: Construction of prokaryotic expression vector for medicinal wild rice gene OobZIP1

[0066] A method for constructing a medicinal wild rice gene OobZIP1 prokaryotic expression vector, comprising the following steps:

[0067] a) PCR amplification: using the target gene recombinant plasmid obtained in Example 1 as a template, using upstream primers such as SEQ ID No.4 and downstream primers such as SEQ ID No.5 to perform PCR amplification, and recover by electrophoresis and gel cutting ;

[0068] SEQ ID No. 4: C GAGCTC ATGGCTTATGATGAAGCTGT;

[0069] SEQ ID No.5: ATTT GCGGCCGC GCTTGCAGCGACAACATCAGTG;

[0070] b) double digestion: use Sac I and Not I to perform double digestion on the gel-cut recovery product obtained in step a), and obtain the enzyme-cut gene fragment after gel recovery;

[0071] c) Ligation: The plasmid pet32a(+) was double-digested with Sac I and Not I, after gel cutting and recovery, it was ligated with the enzyme-cut gene fragment o...

Embodiment 3

[0076] Example 3: Construction of OobZIP1 overexpression vector for medicinal wild rice gene

[0077] A method for constructing a medicinal wild rice gene OobZIP1 expression vector, comprising the following steps:

[0078] a) PCR amplification: using the target gene recombinant plasmid obtained in Example 1 as a template, using upstream primers such as SEQ ID No.6 with Sma I and Xba I restriction sites and as shown in SEQ ID No.7 The downstream primers were used for PCR amplification and gel recovery by electrophoresis;

[0079] SEQ ID No. 6: TCC CCCGGG ATGGCTTATGATGAAGCTGTTGCTA;

[0080] SEQ ID No. 7: GC TCTAGA TTAGCTTGCAGCGACAACATCAGTG;

[0081] b) double enzyme digestion: use Sma I and Xba I to perform double enzyme digestion on the gel-cut recovery product obtained in step a), and obtain the enzyme-cut gene fragment after gel recovery;

[0082] c) Ligation: Plasmid pCAMBIA1301 was double digested with Sma I and Xba I, after gel cutting and recovery, it was ligated...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a medical wild rice gene OobZIp1 as well as an expression vector and a construction method thereof. The sequence of the medical wild rice gene OobZIp1 is shown in SEQ ID No.1. The amino acid sequence encoded by the gene is shown in SEQ ID No.16. The wild rice gene OobZIp1 has complete CDS region, and the upregulation genes are significant in expression and belong to G subgroups of bZIP family; the OobZIp1 has transcriptional activation activity; the OobZIp1 expression amount in the transgenic plant obtained by the OobZIp1 is significantly increased, and the transgenic plant has stress resistance of salt resistance and drought resistance.

Description

technical field [0001] The invention relates to the field of rice genetic engineering, in particular to a medicinal wild rice gene OobZIP1, an expression vector and a construction method thereof. Background technique [0002] Rice is one of the most important food crops in the world, and it is also the largest food crop in my country. Abiotic stresses such as drought will seriously affect the growth and yield of rice. [0003] In the Oryza genus, only two Asian cultivated rice (O. sativa L.) and African cultivated rice (O. glaberrima Steud) are cultivated species, and the remaining 20 species are all wild rice. Growing, through resisting the invasion of diseases and insect pests and the natural selection of adverse environment, wild rice contains a large number of good genes, which is a natural gene treasure house (E Zhiguo et al., Genetics, 2008(11):1397-1405., 2008). However, because of serious reproductive barriers between it and cultivated rice (AA genome), its favorab...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/66C12N15/82C07K14/415A01H5/00A01H6/46
Inventor 陈志雄戴双凤刘向东谢海媚夏昌选谭碧兰
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com