Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Medical wild rice gene OobZIp1 as well as expression vector and construction method thereof

A technology of medicinal wild rice and expression vectors, which is applied in the field of medicinal wild rice gene OobZIP1 and its expression vector and construction, and can solve the problems of inefficient use of favorable traits and reproductive barriers

Active Publication Date: 2015-12-23
SOUTH CHINA AGRI UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because of serious reproductive barriers between it and cultivated rice (AA genome), its beneficial traits have not been efficiently utilized at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Medical wild rice gene OobZIp1 as well as expression vector and construction method thereof
  • Medical wild rice gene OobZIp1 as well as expression vector and construction method thereof
  • Medical wild rice gene OobZIp1 as well as expression vector and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Preparation of the medicinal wild rice gene OobZIP1 target gene

[0051] A medicinal wild rice gene OobZIP1 is prepared through the following steps:

[0052] 1) Extracting medicinal wild rice RNA;

[0053] 2) Synthesis of the first strand of cDNA: use the ZeroBackFastLigationKit kit to synthesize the first strand of cDNA;

[0054] 3) PCR amplification: using the first strand of cDNA as a template, using the upstream primer shown in SEQIDNo.2 and the downstream primer shown in SEQIDNo.3, perform PCR amplification to obtain the target gene band, and recover by gel electrophoresis ;

[0055] Among them, PCR amplification reaction system: 10×PCRBufferforKOD-Plus-Neo5μL; 2mMdNTPs5μL; 25mMMgSO 4 3 μL; upstream primer (10 μM) 1.5 μL, downstream primer (10 μM) 1.5 μL; template 5 μL; KOD-Plus-Neo (1U·μL-1) 1 μL; times;

[0056] The PCR reaction program is: after pre-denaturation at 95°C for 15 minutes, the fluorescence signal is collected at 95°C for 20 sec; at...

Embodiment 2

[0059] Example 2: Construction of prokaryotic expression vector for medicinal wild rice gene OobZIP1

[0060] A method for constructing a medicinal wild rice gene OobZIP1 prokaryotic expression vector, comprising the following steps:

[0061] a) PCR amplification: using the target gene recombinant plasmid obtained in Example 1 as a template, using an upstream primer such as SEQIDNo.4 and a downstream primer such as SEQIDNo.5, to perform PCR amplification, and recover by electrophoresis and gel cutting;

[0062] SEQ ID No. 4: C GAGCTC ATGGCTTATGATGAAGCTGT;

[0063] SEQ ID No. 5: ATTT GCGGCCGC GCTTGCAGCGACAACATCAGTG;

[0064] b) double digestion: use SacI and NotI to perform double digestion on the gel-cut recovery product obtained in step a), and obtain the enzyme-cut gene fragment after gel recovery;

[0065] c) Ligation: The plasmid pet32a(+) was double-digested with SacI and NotI, and after recovery from gel cutting, it was ligated with the digested gene fragment obt...

Embodiment 3

[0070] Example 3: Construction of OobZIP1 overexpression vector for medicinal wild rice gene

[0071] A method for constructing a medicinal wild rice gene OobZIP1 expression vector, comprising the following steps:

[0072] a) PCR amplification: with the objective gene recombinant plasmid that obtains in embodiment 1 as template, adopt the upstream primer such as SEQIDNo.6 and the downstream primer as shown in SEQIDNo.7 that have SamI, XbaI restriction site, carry out PCR Amplification, electrophoresis and gel recovery;

[0073] SEQ ID No. 6: TCC CCCGGG ATGGCTTATGATGAAGCTGTTGCTA;

[0074] SEQ ID No. 7: GC TCTAGA TTAGCTTGCAGCGACAACATCAGTG;

[0075] b) double digestion: use SamI and XbaI to perform double digestion on the gel-cut recovery product obtained in step a), and obtain the enzyme-cut gene fragment after gel recovery;

[0076] c) Ligation: Plasmid pCAMBIA1301 was double-enzymatically digested with SamI and XbaI, after gel cutting and recovery, ligated with the di...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a medical wild rice gene OobZIp1 as well as an expression vector and a construction method thereof. The sequence of the medical wild rice gene OobZIp1 is shown in SEQ ID No.1. The amino acid sequence encoded by the gene is shown in SEQ ID No.16. The wild rice gene OobZIp1 has complete CDS region, and the upregulation genes are significant in expression and belong to G subgroups of bZIP family; the OobZIp1 has transcriptional activation activity; the OobZIp1 expression amount in the transgenic plant obtained by the OobZIp1 is significantly increased, and the transgenic plant has stress resistance of salt resistance and drought resistance.

Description

technical field [0001] The invention relates to the field of rice genetic engineering, in particular to a medicinal wild rice gene OobZIP1, an expression vector and a construction method thereof. Background technique [0002] Rice is one of the most important food crops in the world, and it is also the largest food crop in my country. Abiotic stresses such as drought will seriously affect the growth and yield of rice. [0003] In the Oryza genus, only two Asian cultivated rice (O. sativa L.) and African cultivated rice (O. glaberrima Steud) are cultivated species, and the remaining 20 species are all wild rice. , through resisting the invasion of diseases and insect pests and the natural selection of adverse environment, wild rice contains a large number of good genes, which is a natural gene treasure house (E Zhiguo et al., Genetics, 2008 (11): 1397-1405., 2008). However, because of serious reproductive barriers between it and cultivated rice (AA genome), its favorable tr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/66C12N15/82C07K14/415A01H5/00
Inventor 陈志雄戴双凤刘向东谢海媚夏昌选谭碧兰
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com