Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Medicinal wild rice gene OobZIP2, and expression vector and construction method thereof

A technology of medicinal wild rice and expression vector, which is applied in the field of medicinal wild rice gene OobZIP2 and its expression vector and construction, and can solve the problems of ineffective utilization of favorable traits, reproductive obstacles and the like

Active Publication Date: 2015-12-23
SOUTH CHINA AGRI UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because of serious reproductive barriers between it and cultivated rice (AA genome), its beneficial traits have not been efficiently utilized at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Medicinal wild rice gene OobZIP2, and expression vector and construction method thereof
  • Medicinal wild rice gene OobZIP2, and expression vector and construction method thereof
  • Medicinal wild rice gene OobZIP2, and expression vector and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Preparation of the medicinal wild rice gene OobZIP2 target gene

[0051] A medicinal wild rice gene OobZIP2 is prepared through the following steps:

[0052] 1) Extracting medicinal wild rice RNA;

[0053] 2) Synthesis of the first strand of cDNA: use the ZeroBackFastLigationKit kit to synthesize the first strand of cDNA;

[0054] 3) PCR amplification: using the first strand of cDNA as a template, using the upstream primer shown in SEQIDNo.2 and the downstream primer shown in SEQIDNo.3, perform PCR amplification to obtain the target gene band, and recover by gel electrophoresis ;

[0055] SEQ ID No. 2: CCGTCAAATCAAGCACCCC

[0056] SEQ ID No. 3: TTGATATGAACACAGCGAGCC

[0057] Among them, PCR amplification reaction system: 10×PCRBufferforKOD-Plus-Neo5μL; 2mMdNTPs5μL; 25mMMgSO 4 3 μL; upstream primer (10 μM) 1.5 μL, downstream primer (10 μM) 1.5 μL; template 5 μL; KOD-Plus-Neo (1U·μL-1) 1 μL; Autoclaved, distilledwater 28 μL; times;

[0058] The PCR rea...

Embodiment 2

[0061] Embodiment 2: Construction of prokaryotic expression vector of medicinal wild rice gene OobZIP2

[0062] A method for constructing a medicinal wild rice gene OobZIP2 prokaryotic expression vector, comprising the following steps:

[0063] a) PCR amplification: using the target gene recombinant plasmid obtained in Example 1 as a template, using an upstream primer such as SEQIDNo.4 and a downstream primer such as SEQIDNo.5, to perform PCR amplification, and recover by electrophoresis and gel cutting;

[0064] SEQ ID No. 4: C GAGCTC ATGGGGAATGATGAAGC;

[0065] SEQ ID No. 5: ATTT GCGGCCGC CCTTGCGGCTACAGCATCAGTC;

[0066] b) double digestion: use SacI and NotI to perform double digestion on the gel-cut recovery product obtained in step a), and obtain the enzyme-cut gene fragment after gel recovery;

[0067] c) Ligation: the plasmid pet32a(+) was double-enzymatically digested with SacI and NotI, and after recovery from gel cutting, it was ligated with the digested gene...

Embodiment 3

[0072] Embodiment 3: the construction of medicinal wild rice gene OobZIP2 overexpression vector

[0073] A method for constructing a medicinal wild rice gene OobZIP2 expression vector, comprising the following steps:

[0074] a) PCR amplification: with the objective gene recombinant plasmid that obtains in embodiment 1 as template, adopt the upstream primer such as SEQIDNo.6 and the downstream primer as shown in SEQIDNo.7 that have SamI, XbaI restriction site, carry out PCR Amplification, electrophoresis and gel recovery;

[0075] SEQ ID No. 6: TCC CCCGGG ATGGGGAATGATGAAGC;

[0076] SEQ ID No. 7: GC TCTAGA TTACCTTGCGGCTACAGCATCAGTC;

[0077] b) double digestion: use SamI and XbaI to perform double digestion on the gel-cut recovery product obtained in step a), and obtain the enzyme-cut gene fragment after gel recovery;

[0078] c) Ligation: Plasmid pCAMBIA1301 was double digested with SamI and XbaI, after gel cutting and recovery, ligated with the digested gene fragmen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a medicinal wild rice gene OobZIP2, and an expression vector and a construction method thereof. Particularly, the nucleotide sequence of the medicinal wild rice gene OobZIP2 is disclosed as SEQ ID No.1, and the amino acid sequence coded by the gene is disclosed as SEQ ID No.16. The wild rice gene OobZIP2 has the complete CDS region, and has obvious expression of up-regulated genes which belongs to Subgroup G of Group bZIP. The OobZIP2 has transcription activation activity. The OobZIP2 expression level in the transgenic plant obtained from the OobZIP2 is obviously enhanced, and the transgenic plant has salt tolerance and drought tolerance.

Description

technical field [0001] The invention relates to the field of rice genetic engineering, in particular to a medicinal wild rice gene OobZIP2, an expression vector and a construction method thereof. Background technique [0002] Rice is one of the most important food crops in the world, and it is also the largest food crop in my country. Abiotic stresses such as drought will seriously affect the growth and yield of rice. [0003] In the Oryza genus, only two Asian cultivated rice (O. sativa L.) and African cultivated rice (O. glaberrima Steud) are cultivated species, and the remaining 20 species are all wild rice. , through resisting the invasion of diseases and insect pests and the natural selection of adverse environment, wild rice contains a large number of good genes, which is a natural gene treasure house (E Zhiguo et al., Genetics, 2008 (11): 1397-1405., 2008). However, because of serious reproductive barriers between it and cultivated rice (AA genome), its favorable tr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/66C12N15/82C07K14/415A01H5/00
Inventor 陈志雄戴双凤刘向东谭碧兰谢海媚夏昌选
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com