Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Tumorous stem mustard root nodule ndophytic bacteria GJ-06, clubroot preventing and treating agent containing same and application

A GJ-06, endophytic bacteria technology, applied in the field of endophytic bacteria, can solve the problems of aggravation of clubroot, imbalance of soil microbial ecosystem, increase of soil-borne diseases, etc., achieving good inhibitory effect, good stability, slowing down the disease degree of effect

Inactive Publication Date: 2016-03-02
YANGTZE NORMAL UNIVERSITY
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the discovery of mustard clubroot in Fuling in 1994, the disease has become the main disease of mustard at present, with an incidence of 30-50% in the field. It is difficult to continue planting mustard in diseased fields, resulting in a decline in the planting area of ​​mustard, which seriously threatens mustard. The sustainable development of (Gao Mingquan, Peng Hongjiang, Wang Xu, etc. Determination of damage and yield loss of mustard clubroot in Fuling. Plant Protection, 2002,28(6):31-33; Xiao Chonggang, Guo Xianghua, Han Haibo, etc. Identification and main characteristics of clubroot pathogen of mustard mustard in Fuling. Journal of Southwest Agricultural University, 2002,24(4):539-541)
The continuous cropping period of mustard mustard in Fuling area is 10-20 years. Long-term continuous cropping of a single crop will lead to continuous cropping obstacles, resulting in soil acidification, soil microbial ecosystem imbalance, and increased soil-borne diseases (. ZhangX, PanZ, ZhouX, et al. Autotoxicity and Continuous Cropping Obstacles: AReview .Chinese Journal of Soil Science, 2007, 4:33-38)
At present, the soil in the mustard continuous cropping field in Fuling area has been acidified, and the dormant spores of Plasmodium root are more likely to survive in an acidic environment (Narisawak, OhhiKT, HashibaT. Heteroconium chaetospira .PlantPathology, 2000,49:141-146), which also leads to the increase of clubroot year by year

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumorous stem mustard root nodule ndophytic bacteria GJ-06, clubroot preventing and treating agent containing same and application
  • Tumorous stem mustard root nodule ndophytic bacteria GJ-06, clubroot preventing and treating agent containing same and application
  • Tumorous stem mustard root nodule ndophytic bacteria GJ-06, clubroot preventing and treating agent containing same and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Isolation of endophytic bacteria from the root of Stem mustard:

[0019] Disinfect the root knot and healthy root surface produced by the clubroot of the stem tuber mustard (Yongan lobular), grind it into a slurry in a sterile mortar, and spread it on the NA plate (beef extract 3g / L, peptone 2.5g / L , glucose 5g / L, agar 16g / L.), after culturing at 37°C for 48h, pick bacterial colonies, purify, and set aside.

[0020] The isolated root nodule endophytic bacteria were preliminarily identified by colony morphology and Gram staining, and a total of 8 strains of endophytic bacteria were obtained, and the preliminary labels were GJ-01, GJ-02, GJ-03, GJ-04, GJ-05 , GJ-06, GJ-07, and GJ-08 were cultured in NA medium for liquid fermentation at a temperature of 37°C for 12 hours, and were used in subsequent experiments, with clear water as the control (CK).

Embodiment 2

[0022] Identification of endophytic bacteria:

[0023] Primers (16S-F: agagtttgatcctggctcag, 16S-R: tacggctaccttgttacgactt) were designed with the bacterial universal primer 16SrDNA sequence, using the PCR method (95°C, 5min; 95°C, 30s, 55°C, 30s, 72°C, 1min30s, 32cycle; 72 ℃, 10min; 12℃, forever) to amplify the 16SrDNA sequence of the GJ-06 strain, transform the amplified sequence into Escherichia coli competent cells, pick positive clones for sequencing, and compare and analyze in NCBI to determine their taxonomic status; the results show that GJ- 06 was 100% consistent with the 16S rDNA sequence of Bacteria, Firmicutes, Bacillus, Bacillus, Bacillus, and Bacillus, indicating that the bacteria belonged to Bacillus subtilis.

[0024] The GJ-06 strain was characterized by a high-power microscope (10 times the eyepiece, 100 times the objective lens, and 1000 times the magnification) and a scanning electron microscope to analyze its morphological characteristics and determine the...

Embodiment 3

[0026] Analysis of resistance of endophytic bacteria to clubroot in mustard mustard:

[0027] Select the stem mustard plots with severe clubroot disease to carry out, and when transplanting, cut the roots of the stem mustard seedlings,

[0028] Eight kinds of bacterial strain suspensions (1 × 10 9 cfu mL -1 ) were added water to 500mL and mixed evenly, and each treatment of 100 roots was carried out, and the operation was repeated 3 times. With clear water as the blank control, the plots are randomly arranged, and the management is the same as that of ordinary fields. The field disease rate and disease index were investigated in the treatment area and the control area respectively, and the control effect of the strains in the treatment area was calculated.

[0029] The severity of clubroot mustard disease is graded as 5 grades, and the standards are (Gao Mingquan, 2012):

[0030] Grade 0: Healthy plants.

[0031] Grade 1: Onset of lateral roots, small and few tumors, whit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses tumorous stem mustard root nodule ndophytic bacteria GJ-06, a clubroot preventing and treating agent containing same and application. The tumorous stem mustard root nodule ndophytic bacteria (Bacillus subtilis) GJ-06 is deposited the China Center for Type Culture Collection with accession number of CCTCC NO: M 2015665 on November 9, 2015; the clubroot preventing and treating agent comprises the tumorous stem mustard root nodule ndophytic bacteria GJ-06 which serve as effective ingredients; and the tumorous stem mustard root nodule ndophytic bacteria GJ-06 and the clubroot preventing and treating agent can be used for preventing and treating clubroot. By the ndophytic bacteria GJ-06, the clubroot index of tumorous stem mustard is reduced to 36.1 from 75.3, the preventing and treating rate on the tumorous stem mustard reaches 52%, field clubroot degree can be reduced effectively, and an unexpected effect is achieved.

Description

technical field [0001] The invention belongs to the technical field of endophytes, and in particular relates to a kind of endophytic bacteria ( Bacillus subtilis ) GJ-06, a clubroot control agent containing the endophytic bacteria and its application. Background technique [0002] Plasmodium brassicae ( Plasmodiophora brassicae Woron) belongs to the Plasmobacteriaceae of the protozoan kingdom Pluzobacteria Pluzobacteria Pluzobacteria Pluzobacteriaceae, which mainly harms cruciferous plants such as Chinese cabbage, rapeseed, mustard mustard, radish, and causes plant roots to swell, affecting plant absorption. The infection of clubroot causes the epidermis of the plant root to rupture, and other pathogens in the soil invade, causing the root system to rot, the plant to be short and yellow, or even die, and the yield to be severely reduced. Plasmodium brassicae can survive in the soil for a long time. Once the disease occurs in the field, it is difficult to eliminate, and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A01N63/00A01P3/00C12R1/125
Inventor 王殿东潘丽梅谭永忠王旭祎田雪亮曾甜姜清敏
Owner YANGTZE NORMAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More