Uses and related drugs of human RBM17 gene

A gene and drug technology, applied in the application of human RBM17 gene and its related drug fields

Active Publication Date: 2016-07-27
SHANGHAI JI KAI GENE TECH CO LTD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the experimental reports on the RBM17 gene in tumor-related fields are still blank, especially in the field of human glioma research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Uses and related drugs of human RBM17 gene
  • Uses and related drugs of human RBM17 gene
  • Uses and related drugs of human RBM17 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Example 1 Preparation of RNAi lentivirus for human RBM17 gene

[0078] 1. Screening for effective siRNA targets against the human RBM17 gene

[0079] Retrieve RBM17 (NM_032905) gene information from Genbank; design effective siRNA targets for RBM17 gene. Table 1 lists one of the effective siRNA target sequences for the RBM17 gene.

[0080] Table 1 is targeted at the siRNA target sequence of human RBM17 gene

[0081] SEQ ID NO

TargetSeq

1

ATACTTAAGTGTCCTACTAAA

[0082] 2. Preparation of lentiviral vector

[0083] Aiming at the siRNA target (taking SEQIDNO: 1 as an example) synthetic double-stranded DNA Oligo sequence (table 2) containing AgeI and EcoRI restriction endonuclease at both ends; Acting on the pGCSIL-GFP vector ( Provided by Shanghai Jikai Gene Chemical Technology Co., Ltd., figure 1 ), to linearize it, and identify the digested fragments by agarose gel electrophoresis.

[0084] Table 2 Double-stranded DNA Oligo with sticky...

Embodiment 2

[0102] Example 2 Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of RBM17 gene

[0103] The glioma U251 cells in the logarithmic growth phase were trypsinized to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, U251:5) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of cultivation, and the cells were collected after the infection time reached 5 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 7 for the reverse transcription reaction system, react at 42° C. for 1 h, and then bathe in a water bath at 70° C. for 10 min to inactivate reverse transcriptase).

[0...

Embodiment 3

[0110] Example 3 Detection of proliferation ability of tumor cells infected with RBM17-siRNA lentivirus

[0111] The glioma U251 cells in the logarithmic growth phase were trypsinized to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, U251:5), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plate was detected and read once a day with a Cellomics ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses uses and related drugs of a human RBM17 gene. The invention discloses the uses of the human RBM17 gene in tumor therapy, tumor diagnosis and drug preparation. The invention further discloses a human RBM17 gene small-molecular interference RNA, a human RBM17 gene interference nucleic acid construction body and a human RBM17 gene interference slow virus and uses thereof. The siRNA or the siRNA sequence-containing nucleic acid construction body and slow virus provided by the invention, especially the slow virus, can specifically inhibit expression of the human RBM17 gene, can efficiently infect target cells, efficiently inhibit expression of the RBM17 gene in the target cells, inhibit the growth of the tumor cells, promote the apoptosis of the tumor cells and have important significance in tumor therapy.

Description

technical field [0001] The present invention relates to the field of biotechnology, and more specifically relates to the use of human RBM17 gene and related medicines. Background technique [0002] RNA interference (RNAi) is short double-stranded RNA (dsRNA) composed of nucleotides for post-transcriptional gene silencing. It can efficiently and specifically block the expression of a specific gene in the body, leading to its degradation, thereby causing the silencing of a specific gene in the organism, and causing the cells to show the absence of a certain gene phenotype. It is a commonly used research gene emerging in recent years. Functional, laboratory techniques for finding cures for disease. Studies have shown that double-stranded RNA with a length of 21-23nt can specifically cause RNAi at the transcriptional and post-transcriptional levels (TuschlT, ZamorePD, SharpPA, BartelDP. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21to23nucleotide int...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/113C12N15/867A61K31/713A61P35/00
Inventor 谭畅刘书童王庆亮杨敏徐述曹跃琼
Owner SHANGHAI JI KAI GENE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap