A thermosensitive mutant of xylanase and its preparation method and application

A technology of xylanase mutation and xylanase, which is applied in the field of xylanase thermosensitive mutants and its preparation, can solve the problems of easy heat inactivation, poor thermal stability of enzymes, etc., and achieve the effect of low activity

Active Publication Date: 2019-08-06
YUNNAN NORMAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Heat-sensitive enzymes have poor thermal stability and are easily inactivated by heat

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A thermosensitive mutant of xylanase and its preparation method and application
  • A thermosensitive mutant of xylanase and its preparation method and application
  • A thermosensitive mutant of xylanase and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Construction of mutant library

[0032] Genomes of Arthrobacter sp. and Lechevalieria sp. were extracted according to the instructions of the GENE STAR Bacterial Genome Extraction Kit. According to GenBank xylanase sequences JQ863105 and JF745868, primers 5'GTCTCGGCCCCGCCGGACGT 3' and 5'GGCTCGCTTCGCCAGCGTGG 3' were designed, and PCR amplification was performed using the genome of Lechevalieria sp. as a template to obtain xylanase The gene xynAHJ3 was designed with primers 5'GTGCAGCCGGAGGAAAAACG 3' and 5'GATGAAGGCAGGATCCGGGGT 3', and the Arthrobacter sp. genome was used as a template for PCR amplification to obtain the xylanase gene xynAGN16L.

[0033] The PCR reaction parameters were: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 1 min and 30 sec, and after 30 cycles, incubation at 72°C for 10 min.

[0034] Using the above PCR product as a template, the error-prone PCR kit was used t...

Embodiment 2

[0037] Example 2: Screening of Mutants

[0038] Take 2 μL of bacterial liquid from the 96-well cell culture plate in which the mutant library was stored, and inoculate it into 200 μL / well liquid LB culture medium (containing 100 μg mL -1 Amp) in a 96-deep-well plate at 37°C with shaking at 200rpm until OD 600 >1.0 (about 20h), add 2mM IPTG and 100μg mL -1 Amp was induced overnight at 20° C. with 160 rpm in 200 μL liquid LB culture solution. Add 40 μL / well of PopCulture after induction TM Cell lysate, shake and lyse cells at 25°C for 30 minutes. Take 50 μL of McIlvaine buffer (pH=7.0) containing 1.0% (w / v) beech xylan and 50 μL of cell lysate, and react in a 96-deep well plate in a 70° C. incubator for 2 hours. After the reaction, add 150 μL of DNS reagent to terminate the reaction, incubate in a 140°C incubator for more than 20 minutes and cool to room temperature, and use a microplate reader to read the OD 540nm The value of E.coli BL21-Gold (DE3) strain lysate reaction gr...

Embodiment 3

[0039] Embodiment 3: Enzyme preparation of mutant S02B12 and wild enzyme rXynAGN16L and rXynAHJ3

[0040] Mutant S02B12, wild enzymes rXynAGN16L and rXynAHJ3 were inoculated in LB (containing 100 μg mL -1 Amp) medium, shake rapidly at 37°C for 16h. Then inoculate the activated bacterial solution into fresh LB (containing 100 μg mL -1 Amp) culture medium, rapid shaking culture for about 2–3h (OD 600 After reaching 0.6–1.0), add IPTG at a final concentration of 0.1 mM for induction, and continue shaking culture at 20° C. for about 20 h. Centrifuge at 12000rpm for 5min to collect the bacteria. After suspending the cells with an appropriate amount of pH=7.0 Tris-HCl buffer solution, the cells were ultrasonically disrupted in a low-temperature water bath. After the crude enzyme solution concentrated in the cells was centrifuged at 13000rpm for 10min, the supernatant was aspirated and the target protein was affinity and purified with Nickel-NTA Agarose and 0-500mM imidazole resp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a xylanase thermosensitive mutant .The sequence of the mutant is shown as SEQ ID No.1 .A preparing method includes the steps that 1, a mutation sequence s02b12 and an expression vector are connected, and a connected product is used for converting escherichia coli to obtain a recombination strain containing s02b12; 2, the recombination strain is cultured, and expression of recombination mutation xylanase is induced; 3, the expressed mutation xylanase S02B12 is recovered and purified; 4, activity of the xylanase S02B12 is measured .The optimal pH value and temperature of the mutation xylanase S02B12 are 5.5 and 50 DEG C respectively, after the xylanse is treated by trypsin and proteinase K at the temperature of 37 DEG C for 1h, enzyme activity is hardly damaged, compared with wild enzymes, thermal properties of the mutation xylanase S02B12 are changed, activity is lower at the temperature of 60 DEG C, inactivation is faster at the temperature of 37 DEG C, and the half-life period at 37 DEG C is shorter than 5 min .The xylanase thermosensitive mutant can be used for low-temperature biotechnology and other fields and particularly used in food industry.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and protein modification, in particular to a thermosensitive mutant of xylanase and a preparation method thereof. Background technique [0002] Plant cell walls are the most abundant biomass on earth, mainly composed of lignin, cellulose and hemicellulose. Xylan is the most abundant polysaccharide in hemicellulose, and its degradation depends on xylanase. Xylanase degrades xylan into xylooligosaccharides and / or xylose, so xylanase can regulate the growth of plant cells, and can be used in the fields of feed, food, brewing, textile and paper making. [0003] Heat-sensitive enzymes have poor thermal stability and are easily inactivated by heat. This characteristic enables the catalytic reaction of the enzyme to be easily controlled, and has application value in low-temperature biotechnology and other fields, especially when there are heat-sensitive substances in the catalytic substrate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/70
CPCC12N9/2482C12Y302/01008
Inventor周峻沛张蕊黄遵锡沈骥冬唐湘华李俊俊吴倩慕跃林
OwnerYUNNAN NORMAL UNIV