Chimeric antigen receptor and gene and recombinant expression vector thereof, carher1-nkt cell and preparation method and application thereof

A chimeric antigen receptor, NKT cell technology, applied in the field of tumor biological products, achieves good industrial application prospects, enhances ability, and enhances the effect of specific killing activity

Active Publication Date: 2019-08-06
GENERAL HOSPITAL OF PLA
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the defect of drug resistance caused by the use of anti-HER1 drugs in the prior art to treat patients with advanced HER1-positive renal cancer, and to provide a chimeric antigen receptor HER1ScFv-CD8-CD137-CD3ζ and its gene And recombinant expression vectors, engineered HER1-targeted NKT cells (CARHER1-NKT cells) and their preparation methods and applications, NKT cells modified by chimeric antigen receptor HER1ScFv-CD8-CD137-CD3ζ in the treatment of advanced HER1-positive renal cancer When using anti-HER1 drugs, it can effectively avoid the drug resistance caused by the use of anti-HER1 drugs, and has certain specific targeting and killing activity on renal cancer cells, and it is also effective for patients who have undergone multiple treatments (such as radiotherapy, chemotherapy and other drug symptomatic treatments, etc.) Patients with advanced HER1-positive kidney cancer who have no obvious curative effect have a certain therapeutic effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor and gene and recombinant expression vector thereof, carher1-nkt cell and preparation method and application thereof
  • Chimeric antigen receptor and gene and recombinant expression vector thereof, carher1-nkt cell and preparation method and application thereof
  • Chimeric antigen receptor and gene and recombinant expression vector thereof, carher1-nkt cell and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0030] The preparation method of the lentiviral expression vector pWPXL-HER1ScFv-CD8-CD137-CD3ζ is not particularly limited, and can be various methods that can be imagined by those skilled in the art. Preferably, the lentiviral expression vector pWPXL-HER1ScFv-CD8-CD137 -The preparation method of CD3ζ comprises the following steps:

[0031] (1) The hinge region and transmembrane region of CD8, the intracellular signaling domain of CD137 and the intracellular signaling domain of CD3ζ were respectively amplified from NKT cell cDNA, and cloned into the vector pWPXL-GFP to construct pWPXL-CD8 - CD137-CD3ζ;

[0032] (2) Synthesize the nucleotide sequence encoding rat growth hormone signal peptide and HER1ScFv, and clone it into pWPXL-CD8-CD137-CD3ζ, and obtain the correct sequence of pWPXL-HER1ScFv-CD8-CD137-CD3ζ after sequencing verification.

[0033] In step (1), there is no particular limitation on the methods for respectively amplifying the hinge region and transmembrane regi...

Embodiment 1

[0084] The preparation of embodiment 1 NKT cell

[0085] (1) Take human venous blood in a vacuum tube containing heparin. Mononuclear cells (PBMCs) were obtained by density gradient centrifugation using lymphocyte separation medium.

[0086] (2) After PBMCs were washed three times, the final concentration of cells was adjusted to 2×10 by using NKT cell culture medium GT-T551 containing 0.6 volume % human autologous serum. 6 cells / mL; the cells were inoculated on a 75 cm 2 in cell culture flasks. Then add recombinant human interleukin-2 with a final concentration of 500U / mL, 50ng / ml CD3 monoclonal antibody and 50ng / mL recombinant human interleukin-15 to the culture medium, at 37°C and saturated humidity of 5% CO 2 cultured in an incubator.

[0087] (3) On the 4th day of culture, transfer the cells to an uncoated culture flask, add NKT cell culture medium GT-T551 every 2 days according to the number of cell growth, and control the cell concentration to 1×10 8 cells / mL, and ...

Embodiment 2

[0088] Example 2 Construction of lentiviral expression vector pWPXL-HER1ScFv-CD8-CD137-CD3ζ

[0089] (1) Preparation of NKT cell cDNA

[0090] The NKT cells cultured in Example 1 were centrifuged to precipitate, and the total RNA of the cells was extracted with RNAiso Reagent, a total RNA extraction kit, and stored at -80°C for future use. Extracted total RNA with RevertAid Reverse Transcription Kit TM NKT cell cDNA was obtained by reverse transcription with the First StrandcDNA Synthesis Kit, and stored at -20°C for future use.

[0091] (2) Preparation of lentiviral plasmid pWPXL-CD8-CD137-CD3ζ

[0092] The following primer sequences were designed and synthesized (wherein, the underline marks are protected bases, and the square boxes are enzyme cleavage sites):

[0093] P1 (SEQ ID NO.11): GATC CTGAGCAACTCCATCATGTACTTC

[0094] MluI

[0095] P2 (SEQ ID NO.12): GATC GCAGTAAAGGGTGATAACCAGTGA

[0096] BglII

[0097] P3 (SEQ ID NO.13): GATC AAACGGGGCAGAAAGAAACT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chimeric antigen receptor, a gene and a recombinant expression vector thereof, a CARHER1-NKT cell and a preparation method and application thereof. The chimeric antigen receptor is HER1ScFv-CD8-CD137-CD3 zeta, and comprises a rat growth hormone signal peptide, HER1ScFv, a hinge region and a transmembrane domain of CD8, an intracellular signaling structural domain of CD137 and an intracellular signaling structural domain of CD3 zeta, which are in series connection. The CARHER1-NKT cells for the treatment of HER1 positive kidney cancer in later stage can effectively avoid the drug resistance caused by the existing drugs targeting HER1, have certain specific killing activity on kidney cancer cells, and have certain therapeutic effect on patients treated with multiple times of therapies (such as radiotherapy, chemotherapy and other drug symptomatic treatment) with HER1 positive kidney cancer in later stage.

Description

technical field [0001] The invention belongs to the field of tumor biological products, and in particular relates to a chimeric antigen receptor HER1ScFv-CD8-CD137-CD3ζ in adoptive immunotherapy, its gene and recombinant expression vector, and engineered HER1-targeted NKT cells (CARHER1 -NKT cells) and applications thereof. Background technique [0002] EGFR (epithelial growth factor receptor, epidermal growth factor receptor) or HER1 is the expression product of the proto-oncogene c-erbB1, which belongs to the human epidermal growth factor receptor (HER) family, and itself has tyrosinase kinase activity. The combination of epidermal growth factor (EGF) can activate related genes in the nucleus, thereby promoting cell division and proliferation. HER1 is highly expressed in a variety of malignant tumors. Studies have found that the HER1 signaling pathway plays an important role in the pathogenesis of renal cancer. At the same time, compared with normal renal tissue, the expr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N5/10A61K38/17A61P35/00
Inventor郭业磊丰恺超王瑶伍志强代汉仁王晓慧韩为东
OwnerGENERAL HOSPITAL OF PLA