Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chimeric antigen receptors and their genes and recombinant expression vectors, engineered her1-targeted nkt cells and their applications

A chimeric antigen receptor and NKT cell technology is applied in the field of tumor biological products to achieve the effect of enhancing specific killing activity, enhancing ability, and good industrial application prospects

Active Publication Date: 2019-08-02
SHANGHAI CELLULAR BIOPHARMACEUTICAL GROUP LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the defect of drug resistance caused by the use of HER1 tyrosine kinase inhibitors in the prior art to treat patients with advanced HER1-positive lung cancer, and to provide a chimeric antigen receptor HER1ScFv-CD8-CD137-CD3ζ And its gene and recombinant expression vector, engineered HER1-targeted NKT cells (CARHER1-NKT cells) and its application, NKT cells modified by chimeric antigen receptor HER1ScFv-CD8-CD137-CD3ζ in the treatment of advanced HER1-positive lung cancer When used, it can effectively avoid the drug resistance caused by the use of HER1 tyrosine kinase inhibitors, and has certain specific targeting and killing activity on lung cancer cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptors and their genes and recombinant expression vectors, engineered her1-targeted nkt cells and their applications
  • Chimeric antigen receptors and their genes and recombinant expression vectors, engineered her1-targeted nkt cells and their applications
  • Chimeric antigen receptors and their genes and recombinant expression vectors, engineered her1-targeted nkt cells and their applications

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0026] The preparation method of the lentiviral expression vector pWPT-HER1ScFv-CD8-CD137-CD3ζ is not particularly limited, and can be various methods that can be imagined by those skilled in the art. Preferably, the lentiviral expression vector pWPT-HER1ScFv-CD8-CD137 -The preparation method of CD3ζ comprises the following steps:

[0027] (1) The hinge region and transmembrane region of CD8, the intracellular signaling domain of CD137 and the intracellular signaling domain of CD3ζ were respectively amplified from NKT cell cDNA, and cloned into the vector pWPT-GFP to construct pWPT-CD8 - CD137-CD3ζ;

[0028] (2) Synthesize the nucleotide sequence encoding the signal peptide of rat growth hormone and HER1ScFv, clone it into pWPT-CD8-CD137-CD3ζ, and obtain the correct sequence of pWPT-HER1ScFv-CD8-CD137-CD3ζ after sequencing verification.

[0029] In step (1), there is no particular limitation on the methods for respectively amplifying the hinge region and transmembrane region ...

Embodiment 1

[0063] Example 1 Preparation of NKT cells

[0064] (1) Take human venous blood in a vacuum tube containing heparin. Mononuclear cells (PBMCs) were obtained by density gradient centrifugation using lymphocyte separation medium.

[0065] (2) After the PBMCs were washed three times, the final cell concentration was adjusted to 2×10 by using NKT cell culture medium GT-T551 containing 0.6% by volume of fetal bovine serum. 6 cells / mL; the cells were inoculated in a 75cm 2 in cell culture flasks. Then add recombinant human protein interferon-γ with a final concentration of 1000U / mL and recombinant human interleukin-2 with a final concentration of 1000U / mL in the culture medium, and incubate at 37°C with a saturated humidity of 5% CO 2 cultured in an incubator.

[0066] (3) On the fourth day, 100 mL of NKT cell culture medium GT-T551 containing 0.6 vol% fetal bovine serum was added to the culture flask, and recombinant human interleukin 2 with a final concentration of 1000 U / mL wa...

Embodiment 2

[0067] Example 2 Construction of lentiviral expression vector pWPT-HER1ScFv-CD8-CD137-CD3ζ

[0068] (1) Preparation of NKT cell cDNA

[0069]The NKT cells cultured in Example 1 were centrifuged to precipitate, and the total RNA of the cells was extracted with RNAiso Reagent, a total RNA extraction kit, and stored at -80°C for future use. Extracted total RNA with RevertAid Reverse Transcription Kit TM NKT cell cDNA was obtained by reverse transcription with the First StrandcDNA Synthesis Kit, and stored at -20°C for future use.

[0070] (2) Preparation of lentiviral plasmid pWPT-CD8-CD137-CD3ζ

[0071] The following primer sequences were designed and synthesized (wherein, the underline marks are protected bases, and the square boxes are enzyme cleavage sites):

[0072] P1 (SEQ ID NO.11): GATC CTGAGCAACTCCATCATGTACTTC

[0073] MluI

[0074] P2 (SEQ ID NO.12): GATC GCAGTAAAGGGTGATAACCAGTGA

[0075] BglII

[0076] P3 (SEQ ID NO.13): GATC AAACGGGGCAGAAAGAAACTCC ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided are a chimeric antigen receptor as well as a gene and a recombinant expression vector thereof and an engineered HER1-targeted NKT cell. The chimeric antigen receptor is HER1ScFv-CD8-CD137-CD3ζ, which is composed of HER1ScFv, a hinge region and a transmembrane region of CD8, an intracellular signal structural domain of CD137 and an intracellular signal structural domain of CD3ζ connected in series, and can be used to kill lung cancer cells.

Description

technical field [0001] The invention belongs to the field of tumor biological products, and in particular relates to a chimeric antigen receptor HER1ScFv-CD8-CD137-CD3ζ in adoptive immunotherapy, its gene and recombinant expression vector, and engineered HER1-targeted NKT cells (CARHER1 -NKT cells) and applications thereof. Background technique [0002] EGFR (epithelial growth factor receptor, epidermal growth factor receptor) or HER1 is the expression product of the proto-oncogene c-erbB1, which belongs to the human epidermal growth factor receptor (HER) family, and itself has tyrosinase kinase activity. The combination of epidermal growth factor (EGF) can activate related genes in the nucleus, thereby promoting cell division and proliferation. HER1 is highly expressed in a variety of malignant tumors. Studies have found that HER1 is expressed in most lung cancer patients, with an expression level of 80%, and its expression level is related to the progression and metastasi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N5/10A61K39/00A61P35/00
CPCA61K35/12C07K19/00C12N5/10C12N15/62C12N15/867
Inventor 韩为东韩庆旺王晓慧郭业磊丰恺超付小兵
Owner SHANGHAI CELLULAR BIOPHARMACEUTICAL GROUP LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com