Check patentability & draft patents in minutes with Patsnap Eureka AI!

A pair of sgRNA that specifically recognizes the intron of pig igf2 gene, its coding DNA and its application

A technology of introns and DNA molecules, applied in recombinant DNA technology, DNA/RNA fragments, genetic engineering, etc., can solve the problems of IGF2 gene organization and the complexity of temporal and spatial expression, and achieve reduced off-target phenomena, strong specificity, and high The effect of lean meat

Active Publication Date: 2018-06-26
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Distinct spatiotemporal expression of four different promoters presents a high degree of complexity in the organization and spatiotemporal expression of the IGF2 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A pair of sgRNA that specifically recognizes the intron of pig igf2 gene, its coding DNA and its application
  • A pair of sgRNA that specifically recognizes the intron of pig igf2 gene, its coding DNA and its application
  • A pair of sgRNA that specifically recognizes the intron of pig igf2 gene, its coding DNA and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1, complete set of sgRNA and its application

[0030] 1. Preparation of a complete set of sgRNA mediated by Cas9 system to delete the ZBED6 binding site in intron 3 of the IGF2 gene in pig embryos

[0031] 1. In vitro transcription vector construction

[0032] According to the intron 3 of the IGF2 gene in the pig embryo as the targeting sequence, the oligonucleotide (Oligo) DNA sequence was designed and sent to a reliable commercial primer synthesis company for synthesis (1OD for each synthesis, and PAGE was selected as the purification method). The specific sequence is as follows:

[0033] (1)IGF2-sgL2:

[0034] IGF2-sgL-up2: TAGGACTGGTTTCGCCCTCCTCCG

[0035] IGF2-sgL-dn: AAACCGGAGGAGGGCGAAACCAGT

[0036] (2)IGF2-sgR2:

[0037] IGF2-sgR-up2: TAGGAGCAGCGCCCCGACGCGCCC

[0038] IGF2-sgR-dn: AAACGGGCGCGTCGGGGCGCTGCT

[0039] The above two pairs of oligo DNA were annealed separately to form double-stranded DNA fragments IGF2-sgL2 and IGF2-sgR2 with cohesiv...

Embodiment 2

[0063] Embodiment 2, the preparation of complete set of sgRNA

[0064] A set of sgRNAs can also be prepared as follows:

[0065] Design the oligonucleotide (Oligo) DNA sequence according to the sgRNA target sequence, and send it to a reliable commercial primer synthesis company for synthesis (1OD for each synthesis, and select PAGE for the purification method). The specific sequence is as follows:

[0066] (1)IGF2-sgL:

[0067] IGF2-sgL-up: CACCACTGGTTTCGCCCTCCTCCG

[0068] IGF2-sgL-dn: AAACCGGAGGAGGGCGAAACCAGT

[0069] (2)IGF2-sgR:

[0070] IGF2-sgR-up: CACCAGCAGCGCCCCGACGCGCCC

[0071] IGF2-sgR-dn: AAACGGGCGCGTCGGGGCGCTGCT

[0072] The above two pairs of Oligo DNA were annealed separately to form double-stranded DNA fragments IGF2-sgL and IGF2-sgR with cohesive ends.

[0073] The above-mentioned double-stranded DNA fragments IGF2-sgL and IGF2-sgR with cohesive ends were respectively connected into the pX330 (addgene, Plasimd 42330) after digestion and recovery with th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an sgRNA (Subgnomic Ribonucleic Acid) for specific recognition of a porcine IGF2 (Lnsulin-like growth factors-2) gene intron and an encoding DNA (Deoxyribose Nucleic Acid) and application of sgRNA for the specific recognition of the porcine IGF2 gene intron. The invention provides a complete set of sgRNA which comprises an sgRNA-L-1 and an sgRNA-R-2; in the sgRNA-L-1, the nucleotide sequence for identifying fragments of a target sequence is used as the sequence I; in the sgRNA-R-2, the nucleotide sequence for identifying fragments of a target sequence is used as the sequence II. The sgRNA for the specific recognition of the porcine IGF2 gene intron disclosed by the invention can be used for knocking out a ZBED6 factor binding region in the IGF2 gene intron, so that the development of pig muscle cells can be promoted and the muscle content of a pig can be increased.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a pair of sgRNA specifically recognizing the intron of the pig IGF2 gene, its coding DNA and its application. Background technique [0002] The growth rate and backfat thickness of pigs are one of the important breeding objectives in the current pig industry and have important economic value. However, the growth rate and backfat thickness of pigs are complex traits controlled by multiple genes at different levels, and are the result of the regulatory network formed by multiple genes and their products. It has been found that multiple genes such as MSTN, IGF2, MC4R, JHDM1A, TEF-1, RYR1, and COPB1 have significant effects on economic traits such as backfat thickness and growth rate of pigs, and all of the above genes contain As well as the QTN loci that have important effects on the two traits of growth rate. With so many genes, it will take decades or even...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/85
CPCA01K2227/108A01K2267/02C07K14/65C12N15/1136C12N15/8509C12N2310/10C12N2800/107C12N2800/80C12N2810/10
Inventor 李奎刘志国牟玉莲魏迎辉郑新民
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More