Application of paddy rice miR160b gene in regulation and control on tillering angle

A gene and angle technology, applied in the functional verification and application of miR160b regulating rice tiller angle gene, in the field of genetic improvement, to achieve the effect of improving rice plant type and increasing rice yield

Inactive Publication Date: 2016-10-05
HUAZHONG AGRI UNIV
View PDF6 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in rice, there is no report on the regulation of rice plant architecture by miR160b gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of paddy rice miR160b gene in regulation and control on tillering angle
  • Application of paddy rice miR160b gene in regulation and control on tillering angle
  • Application of paddy rice miR160b gene in regulation and control on tillering angle

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Analysis of rice miR160 gene family members

[0040] According to the latest miRBase (Release 21) (http: / / www.mirbase.org / index.shtml) database, the rice miR160 gene family has a total of 6 members, named miR160a to miR160f in sequence. Each member of this gene family is distributed independently on different chromosomes of rice. The stem-loop structure length and sequence of each member of the miR160 gene family are different, and there are only three core miR160 sequences formed by splicing.

[0041] Table 1 Chromosomal distribution and stem-loop size analysis of rice miR160 gene family members

[0042]

Embodiment 2

[0043] Example 2 miR160b gene expression profile analysis

[0044] In order to analyze the expression pattern of miR160b gene, we extracted the root (R), stem (C), leaf (L) and leaf sheath (LS) of the japonica rice variety Zhonghua 11 (ZH11), which was in the vigorous tillering stage 30 days after transplanting. RNA samples from the six tissue parts of , lateral bud (B), and young ear (P) were passed through miRNA stem-loop RT-PCR (Chen et al., Real-time quantification of microRNAs by stem-loop RT-PCR.Nucleic Acids Res, 2005,33:e179) method to detect the expression level of miR160b gene, and set 3 biological repeats and 2 technical repeats. The primers used are as follows:

[0045] MIR160b ST-RT primer:

[0046] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGCAT, MIR160b Forward primerCAAATGCCTGGCTCCCTGTA, ST-R: 5'GTGCAGGGTCCGAGGT3'. Using U6 as the internal reference, the corresponding primers are U6-L: 5'TACAGATAAGATTAGCATGGCCCC3', U6-R: 5'GGACCATTTCTCGATTTGTACGTG3'. For...

Embodiment 3

[0047] Example 3 Construction of rice miR160b gene overexpression vector and acquisition of transgenic plants

[0048] 1. Construction of rice miR160b gene overexpression vector

[0049] The vector used is pU1301 constructed by the State Key Laboratory of Crop Genetic Improvement of Huazhong Agricultural University where the applicant is located (see Figure 8 ). pU1301 is a commonly used plant genetic transformation vector pCAMBIA1301 in the world (Sun et al., 2004, Xa26, a gene conferring resistance to Xanthomonas oryzae pv.oryzae in rice, encoding a LRR receptor kinase-like protein. Plant Journal.37:517-527) An Agrobacterium-mediated genetic transformation vector carrying a maize ubiquitin promoter with constitutive and overexpression characteristics modified on the basis of the above. The pCAMBIA1301 vector was kindly provided by the Australian CAMBIA Laboratory (Center for the Application of Molecular Biology to International Agriculture). Using the PCR method, the ste...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant gene engineering and particularly relates to an application of a paddy rice miR160b gene in regulation and control on tillering angle. Through over-expression of the miR160b gene, a normal paddy rice plant has a phenotypic change of increased tillering angle, and through inhibition of the miR160b gene, the mutant phenotype of the over-expressed miR160b plant is recovered. The miR160b gene has the function of regulating and controlling plant type of paddy rice, wherein a stem-loop structure DNA sequence of the gene is represented as the SEQ ID No.1, a stem-loop structure precursor RNA sequence formed after transcription is represented as the SEQ ID No.2, and the sequence of a core region in mature miR160b formed after transcription and cutting is represented as the SEQ ID No.3. The invention discloses an expression mode of changing the paddy rice miR160b gene or the genes in other members of the family through gene engineering technology, so that the tillering angle of the paddy rice is regulated and controlled to form an ideal plant type, thereby increasing yield.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. It specifically relates to the functional verification and application of a gene miR160b that regulates rice tiller angle. In the present invention, by overexpressing the miR160b gene, the phenotypic changes of increased tiller angle appear in normal rice plants, and inhibiting the miR160b gene can restore the mutant phenotype of the overexpressed miR160b plants, and also involves verifying the suppression of the target gene by the miRNA through experiments , and then regulate the tiller angle of rice. The invention also relates to the purposeful genetic improvement of rice plant type by using the gene through genetic engineering technology. Background technique [0002] Rice is one of the world's major food crops, serving as a staple food for more than half of the world's population. Rice is a relatively mature and easy-to-operate genetic transformation system with its small genome (a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/82C12Q1/68
Inventor吴昌银李佳丽
OwnerHUAZHONG AGRI UNIV