Application of rice mir160b gene in regulation of tiller angle

A gene and rice technology, applied in the functional verification and application of miR160b regulating rice tiller angle gene, in the field of genetic improvement, to achieve the effect of improving rice plant type and increasing rice yield

Inactive Publication Date: 2018-07-31
HUAZHONG AGRI UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in rice, there is no report on the regulation of rice plant architecture by miR160b gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice mir160b gene in regulation of tiller angle
  • Application of rice mir160b gene in regulation of tiller angle
  • Application of rice mir160b gene in regulation of tiller angle

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Analysis of rice miR160 gene family members

[0040] According to the latest miRBase (Release 21) (http: / / www.mirbase.org / index.shtml) database, the rice miR160 gene family has a total of 6 members, named miR160a to miR160f in sequence. Each member of this gene family is distributed independently on different chromosomes of rice. The stem-loop structure length and sequence of each member of the miR160 gene family are different, and there are only three core miR160 sequences formed by splicing.

[0041] Table 1 Chromosomal distribution and stem-loop size analysis of rice miR160 gene family members

[0042]

Embodiment 2

[0043] Example 2 miR160b gene expression profile analysis

[0044] In order to analyze the expression pattern of miR160b gene, we extracted the root (R), stem (C), leaf (L) and leaf sheath (LS) of the japonica rice variety Zhonghua 11 (ZH11), which was in the vigorous tillering stage 30 days after transplanting. RNA samples from the six tissue parts of , lateral bud (B), and young ear (P) were analyzed by miRNA stem-loop RT-PCR (Chen et al., Real-time quantification of microRNAs by stem-loop RT-PCR.Nucleic Acids Res, 2005 ,33:e179) method to detect the expression of miR160b gene, and set up 3 biological replicates and 2 technical replicates. The primers used are as follows:

[0045] MIR160b ST-RT primer:

[0046] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGCAT, MIR160b Forwardprimer CAAATGCCTGGCTCCCTGTA, ST-R: 5'GTGCAGGGTCCGAGGT3'. Using U6 as the internal reference, the corresponding primers are U6-L: 5'TACAGATAAGATTAGCATGGCCCC3', U6-R: 5'GGACCATTTCTCGATTTGTACGTG3'. Fo...

Embodiment 3

[0047] Example 3 Construction of rice miR160b gene overexpression vector and acquisition of transgenic plants

[0048] 1. Construction of rice miR160b gene overexpression vector

[0049] The vector used is pU1301 constructed by the State Key Laboratory of Crop Genetic Improvement of Huazhong Agricultural University where the applicant is located (see Figure 8 ). pU1301 is a plant genetic transformation vector commonly used in the world pCAMBIA1301 (Sun et al., 2004, Xa26, a gene conferring resistance to Xanthomonas oryzae pv.oryzae in rice, encoding a LRR receptor kinase-like protein. Plant Journal.37:517-527 ) is transformed on the basis of the Agrobacterium-mediated genetic transformation vector carrying the maize ubiquitin promoter with constitutive and overexpression characteristics. The pCAMBIA1301 vector was kindly provided by CAMBIA Laboratory (Center for the Application of Molecular Biology to International Agriculture) in Australia. Using the PCR method, the stem-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant genetic engineering, and in particular relates to the application of rice miR160b gene in regulating tiller angle. By overexpressing the miR160b gene, normal rice plants have a phenotypic change of increased tiller angle, and inhibiting the miR160b gene can restore the mutant phenotype of the overexpressing miR160b plants. The miR160b gene has the function of regulating rice plant type. The DNA sequence of the stem-loop structure of the gene is shown in SEQ ID NO: 1, and the stem-loop structure precursor RNA sequence formed after transcription is shown in SEQ ID NO: 2. After transcription And the mature miR160b core region sequence formed after cleavage is shown in SEQ ID NO:3. Disclosed is the use of genetic engineering technology to change the expression pattern of rice miR160b gene or other member genes of the family, regulate the tiller angle of rice to form an ideal plant type, and achieve the purpose of increasing yield.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. It specifically relates to the functional verification and application of a gene miR160b that regulates rice tiller angle. In the present invention, by overexpressing the miR160b gene, the phenotypic changes of increased tiller angle appear in normal rice plants, and inhibiting the miR160b gene can restore the mutant phenotype of the overexpressed miR160b plants, and also involves verifying the suppression of the target gene by the miRNA through experiments , and then regulate the tiller angle of rice. The invention also relates to the purposeful genetic improvement of rice plant type by using the gene through genetic engineering technology. Background technique [0002] Rice is one of the world's major food crops, serving as a staple food for more than half of the world's population. Rice is a relatively mature and easy-to-operate genetic transformation system with its small genome (a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/82C12Q1/6895
Inventor吴昌银李佳丽
OwnerHUAZHONG AGRI UNIV