Unlock instant, AI-driven research and patent intelligence for your innovation.
Phenylalanine attenuator mutants and phenylalanine operons resolving feedback repression and their applications
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A phenylalanine and operon technology, applied in the field of phenylalanine operons, can solve the problems of L-phenylalanine synthesis pathway and complex regulation methods
Active Publication Date: 2020-07-07
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, the synthesis pathway and regulation of L-phenylalanine in microorganisms are complex, which is the key limiting factor for the efficient fermentation of L-phenylalanine and its derivatives
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0064] Embodiment 1, attenuator mutant regulates the expression of gfp gene
[0065] 1. Construction of recombinant plasmid pACYC184-P thr-trc
[0066] 1. Synthesize the double-stranded DNA molecule shown in sequence 1 of the sequence listing (promoter P thr-trc ).
[0067] 2. Using the genomic DNA of Escherichia coli K12MG1655 as a template, PCR amplification was performed using a primer pair composed of WY1947 and WY1948 to obtain a PCR amplification product.
[0070] 3. Take the PCR amplification product obtained in step 2, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the digested product.
[0071] 4. Take the pACYC184 plasmid, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the vector backbone (about 4.1 kb).
[0072] 5. Ligate the digested product of...
Embodiment 2
[0115] Embodiment 2, preparation phenylalanine
[0116] 1. Construction of recombinant plasmid pACYC184-PJJ
[0117] 1. Synthesize the double-stranded DNA molecule shown in sequence 4 of the sequence listing (promoter P JJ ).
[0118] 2. Using the double-stranded DNA molecule prepared in step 1 as a template, the primer pair composed of WY843 and WY842 is used for PCR amplification to obtain a PCR amplification product.
[0119] WY843: TGC TCTAGA CAATTCCGACGTCTAAGAAA;
[0120] WY842: CCC AAGCTT GGTCAGTGCGTCCTGCTGAT.
[0121] 3. Take the PCR amplification product obtained in step 2, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the digested product.
[0122] 4. Take the pACYC184 plasmid, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the vector backbone (about 4.1 kb).
[0123] 5. Ligate the digested product of step 3 with the vector backbone of step 4 to obtain the recombinant plasmid...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a phenylalanine attenuator mutant, a phenylalanine operon for solving feedback repression and applications thereof. The phenylalanine attenuator mutant is a DNA molecule shown by nucleotides at n1-n2 sites of a sequence 2, wherein n1 is more than or equal to 105 and less than or equal to 118, and n2 is more than or equal to 123 and less than or equal to 176. The gene of the phenylalanine operon for solving the feedback repression is obtained by removing nucleotides at 1-n3 sites of a phenylalanine attenuator in the gene of the phenylalanine operon, wherein n3 is more than or equal to 104 and less than or equal to 117. The method for protecting and eliminating the feedback repression of the phenylalanine operon in microorganisms comprises the following steps of: deleting nucleotides at the 1-n3 sites of the phenylalanine attenuator in the gene of the phenylalanine operon of the microorganism. By adoption of the scheme provided by the invention, the yields of phenylalanine and derivatives can be obviously increased, and the phenylalanine attenuator mutant, the phenylalanine operon and the applications have extremely-important application and promotion values for the production field of the phenylalanine and the derivatives thereof.
Description
technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a phenylalanine attenuator mutant, a phenylalanine operon solving feedback repression and their application. Background technique [0002] L-Phenylalanine (L-Phenylalanine) is one of the eight essential amino acids for humans and animals. It is mainly used as a raw material for the new sweetener Aspartame with high sweetness and low calorie. It is also widely used in food and feed Additives and medicine and other fields. At present, the main method of industrial production of L-phenylalanine at home and abroad is microbial fermentation. In addition, L-phenylalanine can be further derivatized through microbial metabolic pathways to synthesize D-phenylalanine, phenylpyruvate, mandelic acid, phenyl acetate, phenylethanol, phenylethylamine, styrene and cinnamic acid, etc. Compounds of application value. However, the synthesis pathway and regulation of L-phenylalanine in mi...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More