A kind of huperzine A derivative and preparation method thereof
A technology for huperzine A and derivatives, which is applied in the field of biomedicine and can solve the problems of insufficient structural diversity of huperzine A derivatives, cumbersome preparation process and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Isolation of Irpex lacteus ZJUT-HS39
[0032] 1. Collection of samples
[0033] The samples were Huperziaserrata plants collected from Gaoer Township, Pan'an County, Jinhua City, Zhejiang Province in August 2016.
[0034] 2. Isolation of strains
[0035] Wash the collected plants with tap water, immerse them in a container containing 75% ethanol, take them out after 2 minutes, and rinse them with sterile water for 3-5 times; then immerse them in a container containing 0.1% mercuric chloride solution for 1 minute Then take it out, rinse with a large amount of sterile water to remove the residual mercuric chloride solution; under aseptic conditions, peel off the outer skin of the stem of Huperus serrata, then cut into 0.3cm × 0.3cm tissue pieces, and plant them in PDA ( Glucose 3g, potato extract powder 0.5g, KH 2 PO 4 0.2g, 1.5g of agar, add water to 100mL, pH value is natural) culture on the plate, after the colony appears, according to the shape of the c...
Embodiment 2
[0036] Example 2 Molecular Biological Identification of Irpex lacteus ZJUT-HS39
[0037] 1. Extraction of DNA
[0038] Take the fermented liquid cultured for 6 days, collect the mycelia by centrifugation, freeze and grind the mycelium with liquid nitrogen, and then use the SK1375 Genomic DNA Extraction Kit (Shanghai Bioengineering (Shanghai) Co., Ltd.) to extract genomic DNA and perform agarose gel Electrophoresis.
[0039] 2. PCR amplification of the sequence
[0040] The primer sequences are:
[0041] ITS1: 5'TCCGTAGGTGAACCTGCGG3';
[0042] ITS4: 5'TCCTCCGCTTATTGATATGC3'.
[0043] The PCR system (50 μL) is composed of: Template (genome) 10 pmol, primer 1 (10 μM) 1 μL, primer 2 (10 μM) 1 μL, dNTP mix (10Mm each) 1 μL, 10×Taq reaction buffer 5 μL, Taq (5U / μL) 0.25 μL, add water to 50 μL.
[0044] The PCR program was set as follows: 98°C pre-denaturation for 5 minutes, 95°C denaturation for 35 seconds, 55°C renaturation for 35 seconds, 72°C extension for 40 seconds, 35 cy...
Embodiment 3
[0049] Example 3 The method for preparing huperzine A derivatives by transforming Irpex lacteus ZJUT-HS39
[0050] 1. Preparation of Irpex lacteus ZJUT-HS39 fermentation product by fermentation culture
[0051] 1) Strain: Irpex lacteus ZJUT-HS39, the strain has been preserved in the China Center for Type Culture Collection, the preservation number is CCTCC M 2017161, the preservation date is March 31, 2017, and the preservation unit address is China , Wuhan, Wuhan University
[0052] 2) Cultivation and storage on slant
[0053] Solid medium: glucose 3g, potato extract powder 0.5g, KH 2 PO 4 0.2g, 1.5g agar, add water to 100mL, pH value is natural.
[0054] Solid culture method: Irpex lacteus ZJUT-HS39 strain is inoculated on a solid medium slant and cultured at 28°C for 5-7 days. After the solid culture is over, place the slant at 4-10°C and refrigerate for later use. Preparation of 30% glycerol cryovials: Under aseptic conditions, wash the slant of the test tube with 6...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



