Supercharge Your Innovation With Domain-Expert AI Agents!

Quality detection method of Dendrobium huoshanense

A quality inspection method, the technology of Dendrobium huoshanense, applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve problems such as the inability to fully reflect the overall curative effect, and achieve the purpose of interpretation and applicability, accurate quality evaluation, and effective identification and control. quality effect

Active Publication Date: 2018-08-14
北京蓝标一成科技有限公司
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present in this patented technology uses two different techniques - one involves identifying specific characteristics from an extract obtained by treating dried leaves or roots containing certain compounds called chlorophyll-A and bacteriostatic agents like quaternary ammonia salts for better identification purposes during drug development process. This allows us to accurately assess how well these drugs were made based upon their unique properties such as coloration patterns, structure, solubility, etc., which helps researchers improve understanding about them's effectiveness against diseases caused due to harmful organisms.

Problems solved by technology

This patented describes different methods for identifying specific chemical components called dendrogenbeneches (dendrites) found naturally throughout China's mainland areas like North America, Japan, Korea, India, Nepenthions Turkey, Greece, etc., including those related to plants belonging to certain genera: Luteriaceae family, Hydrastanaceae genus, Rhizome Cordae Group B1Cupress Flower, Pterocarpacea Calla, Paederma Basidiolica Glycoproteina Boissianheteroeyne Shiplegna Tetragon, Prismaticola Therapeculata Koidzynchema Yellow Septaria Escherichiae, Opunttebrush Spinosity Explanatus, Papilloma Vessellana Neviculas Microcapsules, Helicosapax punctuates, Aceropsis lychnicus Planthorbliosa Ellagitannah Root White Sage, Platyclay Miner Tree Blinds, Polysilicon Frithophyllodes Techniques For Identification Of Active Ingents Varieties To Construct Its Molecular Footprint Profile By studying this profile, we aim to identify these compounds through spectral techniques.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quality detection method of Dendrobium huoshanense
  • Quality detection method of Dendrobium huoshanense
  • Quality detection method of Dendrobium huoshanense

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Generation sequencing of Dendrobium huoshanense

[0053] First-generation sequencing primer sequences:

[0054] ITS-26SE: 5' GAATTCCCCCGGTTCGCTCGCCGTTAC 3';

[0055] ITS-17SE: 5'ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.

[0056] Amplification and sequencing parameters were: 98°C for 2 min, followed by PCR cycle, the PCR cycle parameters were 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C for incubation after amplification, and proceed Next-Generation Molecular Sequencing.

[0057] Through next-generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium Huoshan.

Embodiment 2

[0058] The extraction method of embodiment 2 Dendrobium Huoshan

[0059] Take a dry sample of Dendrobium Huoshan, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (pore size 0.335mm), accurately weigh 1.000g of Dendrobium powder (the weighing error cannot exceed 0.2%), place it in a 100ml conical flask, add 50mL 75% Methanol (V water:V methanol=25:75), take out after sonicating at room temperature for 30min, filter, and concentrate the filtrate to dryness by rotary evaporation, dissolve with 75% methanol solvent (V water:V methanol=25:75), and finally transfer to Dilute to volume in a 10ml volumetric flask, shake well, and filter with a 0.45μm microporous membrane to obtain a sample solution of Dendrobium huoshanense.

Embodiment 3

[0060] Embodiment 3 The chromatographic detection method of Dendrobium huoshanense extract

[0061] ①Preparation of reference solution

[0062] Precisely weigh 4.10 mg of schavertoside and 4.08 mg of naringenin, respectively, place them in a 10 ml volumetric flask, add 75% (V / V) methanol to dissolve and dilute, and shake well to serve as a stock solution. Store in a 4°C refrigerator for later use.

[0063] Then, a certain amount of the reference substance stock solution was precisely drawn, and diluted with 75% methanol to accurately prepare a mixed reference substance solution of schafftoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared ingredients are diluted. Inject into the high performance liquid chromatograph.

[0064] ②Extraction and processing method of samples for the determination of the content of small molecular components of Dendrobium huoshanensis:

[0065] Take 1.00g of this product powder (passed through a No. 3 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a quality detection method of Dendrobium huoshanense. The quality detection method comprises: 1) sequencing by using ITS-26SE and ITS-17SE as primers to identify the variety ofa to-be-detected Dendrobium herb; 2) carrying out chromatographic detection on n samples to obtain detection data using a chemical small molecule component schaftoside and/or naringenin as a reference component; 3) respectively carrying out fingerprint detection on the samples to obtain the fingerprint peak area value of the full chemical components of Dendrobium huoshanense; and 4) establishingan analysis model by using the content value of the schaftoside and/or naringenin in the chromatographic data as the response variable and using the peak area value of other components in the fingerprint as the independent variable, screening the variable through a Lasso method, and establishing the characteristic fingerprint model related to the chemical small molecule component. According to thepresent invention, through the first-generation sequencing and the characteristic fingerprinting, the quality of Dendrobium huoshanense is precisely identified and controlled.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner 北京蓝标一成科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More