Quality detection method of Dendrobium huoshanense
A quality inspection method, the technology of Dendrobium huoshanense, applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve problems such as the inability to fully reflect the overall curative effect, and achieve the purpose of interpretation and applicability, accurate quality evaluation, and effective identification and control. quality effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1 Generation sequencing of Dendrobium huoshanense
[0053] First-generation sequencing primer sequences:
[0054] ITS-26SE: 5' GAATTCCCCCGGTTCGCTCGCCGTTAC 3';
[0055] ITS-17SE: 5'ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.
[0056] Amplification and sequencing parameters were: 98°C for 2 min, followed by PCR cycle, the PCR cycle parameters were 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C for incubation after amplification, and proceed Next-Generation Molecular Sequencing.
[0057] Through next-generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium Huoshan.
Embodiment 2
[0058] The extraction method of embodiment 2 Dendrobium Huoshan
[0059] Take a dry sample of Dendrobium Huoshan, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (pore size 0.335mm), accurately weigh 1.000g of Dendrobium powder (the weighing error cannot exceed 0.2%), place it in a 100ml conical flask, add 50mL 75% Methanol (V water:V methanol=25:75), take out after sonicating at room temperature for 30min, filter, and concentrate the filtrate to dryness by rotary evaporation, dissolve with 75% methanol solvent (V water:V methanol=25:75), and finally transfer to Dilute to volume in a 10ml volumetric flask, shake well, and filter with a 0.45μm microporous membrane to obtain a sample solution of Dendrobium huoshanense.
Embodiment 3
[0060] Embodiment 3 The chromatographic detection method of Dendrobium huoshanense extract
[0061] ①Preparation of reference solution
[0062] Precisely weigh 4.10 mg of schavertoside and 4.08 mg of naringenin, respectively, place them in a 10 ml volumetric flask, add 75% (V / V) methanol to dissolve and dilute, and shake well to serve as a stock solution. Store in a 4°C refrigerator for later use.
[0063] Then, a certain amount of the reference substance stock solution was precisely drawn, and diluted with 75% methanol to accurately prepare a mixed reference substance solution of schafftoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared ingredients are diluted. Inject into the high performance liquid chromatograph.
[0064] ②Extraction and processing method of samples for the determination of the content of small molecular components of Dendrobium huoshanensis:
[0065] Take 1.00g of this product powder (passed through a No. 3 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


