A kind of quality detection method of dendrobium nobile
A quality inspection method and technology of Dendrobium dendrobii are applied in the directions of measuring devices, instruments, scientific instruments, etc., which can solve problems such as the inability to fully reflect the overall curative effect, achieve strong interpretation pertinence and applicability, solve the dimensional disaster, and effectively identify and quality control
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1 Generation Sequencing of Dendrobium officinale
[0053] First-generation sequencing primer sequences:
[0054] ITS-26SE: 5' GAATTCCCCCGGTTCGCTCGCCGTTAC 3';
[0055] ITS-17SE: 5'ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.
[0056] Amplification and sequencing parameters were: 98°C for 2 min, followed by PCR cycle, the PCR cycle parameters were 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C for incubation after amplification, and proceed Next-Generation Molecular Sequencing.
[0057] Through next-generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium doulip.
Embodiment 2
[0058] The extraction method of embodiment 2 Dendrobium purpurea
[0059] Take a dry sample of Dendrobium dendrobii, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (pore size 0.335mm), accurately weigh 1.000g of Dendrobium Dendrobium powder (the weighing error cannot exceed 0.2%), place it in a 100ml conical flask, and add 50mL 75 % methanol (V water:V methanol=25:75), take out after sonicating for 30min at room temperature, filter, and concentrate the filtrate to dryness by rotary evaporation, dissolve with 75% methanol solvent (V water:V methanol=25:75), and finally transfer Dilute to a volume of 10ml in a volumetric flask, shake well, and filter with a 0.45μm microporous membrane to obtain a sample solution of Dendrobium pauli.
Embodiment 3
[0060] Embodiment 3 The chromatographic detection method of Dendrobium officinale extract
[0061] ①Preparation of reference solution
[0062] Precisely weigh 4.10 mg of schavertoside and 4.08 mg of naringenin, respectively, place them in a 10 ml volumetric flask, add 75% (V / V) methanol to dissolve and dilute, and shake well to serve as a stock solution. Store in a 4°C refrigerator for later use.
[0063] Then, a certain amount of the reference substance stock solution was precisely drawn, and diluted with 75% methanol to accurately prepare a mixed reference substance solution of schafftoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared ingredients are diluted. Inject into the high performance liquid chromatograph.
[0064] ②Extraction and processing method of samples for the determination of the content of small molecular components of Dendrobium officinale:
[0065] Take 1.00g of this product powder (passed through a No. 3 sie...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



