Fusion protein of human serum albumin (HAS) and human mutant hepatocyte growth factor (HGF), and preparation method and application thereof

A technology of hepatocyte growth factor and human serum albumin, applied in the direction of hepatocyte growth/dispersion/tumor cytotoxicity factors, growth factors/inducing factors, biochemical equipment and methods, etc. Problems such as difficult downstream work and complex serum components have achieved the effects of increasing expression, simplifying separation and purification operations, and good application prospects

Inactive Publication Date: 2018-08-21
SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE +1
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The composition of serum is very complex. In addition to containing growth-promoting active ingredients, it also contains certain cytotoxic s

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein of human serum albumin (HAS) and human mutant hepatocyte growth factor (HGF), and preparation method and application thereof
  • Fusion protein of human serum albumin (HAS) and human mutant hepatocyte growth factor (HGF), and preparation method and application thereof
  • Fusion protein of human serum albumin (HAS) and human mutant hepatocyte growth factor (HGF), and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The preparation of embodiment 1.HSA-HGF fusion protein

[0034] (1) Acquisition of HGF mutants

[0035] Amplified by PCR method from the plasmid containing human HGF cDNA, the primers are as follows:

[0036] P1: 5'TCTTGTGCCAAAACGAAACAATTG GAA GTTGTAAATGGGATTCCAACACGAAC 3' (SEQ ID NO. 1)

[0037] A: 5' actggtcaaaggaaaagaagaaatacaattcatgaattcaa 3' (SEQ ID NO.2)

[0038] B: 5'AgcggccgcCTATGACTGTGGTACCTTATATGTTAAAATAA 3' (SEQ ID NO.3)

[0039] P2: 5'GTTCGTGTTGGAATCCCATTTACAAC TTC CAATTGTTTCGTTTTGGCACAAGA 3' (SEQ ID NO. 4)

[0040] The PCR method is as follows: 1 μL of 10 μM primers, 0.1 μL template plasmid, 25 μL primestar (2×), 23 μL water were added to the 50 μL system. The PCR conditions are: pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 70°C for 30 seconds, 30 cycles;

[0041] The PCR products of P1 and A are recovered, and the recovered products of P2 and B are fused at 1:1. The fus...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a fusion protein of a HAS and human mutant HGF, and a preparation method and application thereof. The fusion protein comprises a first region composed of the HSA and a second region composed of the human mutant HGF, wherein the human mutant HGF refers to a mutation of amino acid R at site 494 of a HGF into N, D, K, Q or G. According to the invention, the HSA-HGF fusion protein is prepared from a HGF mutant which is biologically active without the action of proteolytic enzymes, and the fusion protein improves the expression level of the HGF in a CHO system and is simplified in separation and purification while maintaining the biological activity of the HGF. The fusion protein of the invention prolongs the in-vivo half-life of the HGF and increases the expression level of the HGF while maintaining the biological activity of the HGF, and has good application prospects in the pharmaceutical field.

Description

technical field [0001] The invention belongs to the technical field of long-acting fusion protein drugs, and more specifically relates to a fusion protein of human serum albumin and human mutant hepatocyte growth factor and a preparation method thereof. Background technique [0002] Human serum albumin (human serum albumin, HSA) is the most abundant protein in human plasma, accounting for about 60% of the total plasma protein. Mature HSA consists of 585 amino acids, has a molecular weight of 66.5kDa, contains 17 pairs of disulfide bonds, and is generally a single-chain non-glycosylated protein. Under normal circumstances, it is not easily filtered by the glomerulus, and its plasma half-life is about 20 days. HSA is widely used as a plasma volume expander, and can also be used as an excipient and stabilizer for various pharmaceutical preparations and components of serum-free medium. HSA is a stable inert protein that can be used as a drug carrier to endow the drug with bett...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K19/00C12N15/62C12N15/85A61K38/18A61K47/64A61P1/16
CPCC07K14/4753A61K38/00C07K2319/31C12N15/85C12N2800/107
Inventor 张雁云金坚徐栋生万爱妮陈蕴金敏
Owner SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap