A Broad-spectrum Disease-resistant Bacillus Veles and Its Application
A technology of Bacillus Velez and strains, applied in the direction of application, bacteria, fungicides, etc., can solve the problems that have not been seen, and achieve the effect of strong viability, stable performance, and significant control effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] The isolation of embodiment one bacterial strain BPC6
[0041] A total of 10 soil samples were collected from the root circumference of lettuce in Maizhuang Village, Xingshou Town, Changping District, Beijing. Bacteria were separated by the gradient dilution coating plate method, 10g soil samples were placed in 100mL sterile water, 28°C, 180r / min shaking culture for 1h to prepare soil sample suspensions, and the soil suspensions were diluted to 10 with sterile water respectively. -3 、10 -4 、10 -5 Gradient, each pipette 100 μL was evenly spread on LB solid medium, cultured at 28°C for 24 hours, and single colonies with different traits such as color and shape were picked and purified.
[0042] Inoculate the purified strain and Pectinobacillus carotovii in 10 mL of LB medium, culture at 180 r / min, 28 °C for 16 hours, take 100 μL of Pectinocacillus carotosa suspension and spread it on the LB medium, based on the 4 Drill holes at each point with a diameter of 0.8 cm, add...
Embodiment 2
[0043] Physiological and biochemical characteristics identification of the second bacterial strain BPC6
[0044] 1. Identification of morphological characteristics
[0045] With reference to Dong Xiuzhu etc. (Dong Xiuzhu, Cai Miaoying. Common Bacteria System Identification Handbook [M]. Beijing: Science Press, 2001, 186-188.), observe the colony form of BPC6 on the LB solid medium, by leather Ran's staining was used to observe the morphological characteristics of BPC6.
[0046] BPC6 cultured by LB, the morphology is as follows figure 1As shown in A, the diameter of the colony is 0.95-12.3 mm, milky white, opaque, irregular in shape, smooth, moist and shiny on the surface, convex in the center, neat in edge shape, and odorless. Microscopic examination showed Gram-positive bacteria, which were club-shaped and rod-shaped, with a size of (0.6-1.0) μm × (2.0-4.0) μm, with spores ( figure 1 B).
[0047] 2. Physiological and biochemical tests
[0048] With reference to the met...
Embodiment 3
[0052] Molecular Biology Identification of Example Three Bacterial Strain BPC6
[0053] 1. Use Easy Pure Plant Genomic (Beijing Quanshijin Biotechnology Co., Ltd.) kit to extract DNA, and use 1% agarose gel electrophoresis to detect its purity and concentration. Using the extracted genomic DNA as a template, the 16S rDNA sequence was amplified with bacterial universal primers. Primer BSF(27f): AGAGTTTGATCCTGGCTCAG; BSR(1541r): AAGGAGGTGATCCAGCCGCA. PCR reaction conditions: 95°C, 4min; 94°C, 40s, 55°C, 45s, 72°C, 1min, 32 cycles; 72°C, 5min. After the PCR product was detected by 2% agarose gel electrophoresis, it was sequenced by Beijing Biomed Company, and the sequence obtained was shown as SEQ ID NO:3. The measured 16S rDNA sequence was searched for homology on the NCBI nucleic acid database using the Blast program, and the 16S rDNA phylogenetic tree was constructed using the Neighbor-Joining Tree method through the MEGA X software (repeated sampling 1000 times), as shown i...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com