Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A Broad-spectrum Disease-resistant Bacillus Veles and Its Application

A technology of Bacillus Velez and strains, applied in the direction of application, bacteria, fungicides, etc., can solve the problems that have not been seen, and achieve the effect of strong viability, stable performance, and significant control effect

Active Publication Date: 2020-12-15
BEIJING AGRO BIOTECH RES CENT
View PDF14 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are reports that the bacillus isolated from tomato, cotton, and tobacco soil has a control effect on sclerotinia, there is no research on the prevention and control of sclerotia and soft rot bacteria at the same time for a single biocontrol bacterium (Zheng Xuefang, Liu Bo, Zhu Yujing , Ge Cibin, Liu Guohong. Screening and identification of Bacillus for the biocontrol of tomato bacterial wilt[J]. Chinese Journal of Biological Control, 2016, 32(5):657-665.; Li Quansheng, Xie Zongming, Liu Zheng, Zhang Guoli, Wu Dongmei, Tian Ying. Screening and identification of cotton Verticillium wilt antagonistic bacteria H14 and its antagonism mechanism analysis[J]. Chinese Journal of Plant Protection, 2018, 45(6):1204-1211; Cao Minghui, Ran Wei, Yang Xingming, Shen Qirong, Shen Biao. Tobacco Screening of antagonistic bacteria against black shank and its biological effects[J]. Acta Soil Science, 2011, 48(1):151-159.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Broad-spectrum Disease-resistant Bacillus Veles and Its Application
  • A Broad-spectrum Disease-resistant Bacillus Veles and Its Application
  • A Broad-spectrum Disease-resistant Bacillus Veles and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The isolation of embodiment one bacterial strain BPC6

[0041] A total of 10 soil samples were collected from the root circumference of lettuce in Maizhuang Village, Xingshou Town, Changping District, Beijing. Bacteria were separated by the gradient dilution coating plate method, 10g soil samples were placed in 100mL sterile water, 28°C, 180r / min shaking culture for 1h to prepare soil sample suspensions, and the soil suspensions were diluted to 10 with sterile water respectively. -3 、10 -4 、10 -5 Gradient, each pipette 100 μL was evenly spread on LB solid medium, cultured at 28°C for 24 hours, and single colonies with different traits such as color and shape were picked and purified.

[0042] Inoculate the purified strain and Pectinobacillus carotovii in 10 mL of LB medium, culture at 180 r / min, 28 °C for 16 hours, take 100 μL of Pectinocacillus carotosa suspension and spread it on the LB medium, based on the 4 Drill holes at each point with a diameter of 0.8 cm, add...

Embodiment 2

[0043] Physiological and biochemical characteristics identification of the second bacterial strain BPC6

[0044] 1. Identification of morphological characteristics

[0045] With reference to Dong Xiuzhu etc. (Dong Xiuzhu, Cai Miaoying. Common Bacteria System Identification Handbook [M]. Beijing: Science Press, 2001, 186-188.), observe the colony form of BPC6 on the LB solid medium, by leather Ran's staining was used to observe the morphological characteristics of BPC6.

[0046] BPC6 cultured by LB, the morphology is as follows figure 1As shown in A, the diameter of the colony is 0.95-12.3 mm, milky white, opaque, irregular in shape, smooth, moist and shiny on the surface, convex in the center, neat in edge shape, and odorless. Microscopic examination showed Gram-positive bacteria, which were club-shaped and rod-shaped, with a size of (0.6-1.0) μm × (2.0-4.0) μm, with spores ( figure 1 B).

[0047] 2. Physiological and biochemical tests

[0048] With reference to the met...

Embodiment 3

[0052] Molecular Biology Identification of Example Three Bacterial Strain BPC6

[0053] 1. Use Easy Pure Plant Genomic (Beijing Quanshijin Biotechnology Co., Ltd.) kit to extract DNA, and use 1% agarose gel electrophoresis to detect its purity and concentration. Using the extracted genomic DNA as a template, the 16S rDNA sequence was amplified with bacterial universal primers. Primer BSF(27f): AGAGTTTGATCCTGGCTCAG; BSR(1541r): AAGGAGGTGATCCAGCCGCA. PCR reaction conditions: 95°C, 4min; 94°C, 40s, 55°C, 45s, 72°C, 1min, 32 cycles; 72°C, 5min. After the PCR product was detected by 2% agarose gel electrophoresis, it was sequenced by Beijing Biomed Company, and the sequence obtained was shown as SEQ ID NO:3. The measured 16S rDNA sequence was searched for homology on the NCBI nucleic acid database using the Blast program, and the 16S rDNA phylogenetic tree was constructed using the Neighbor-Joining Tree method through the MEGA X software (repeated sampling 1000 times), as shown i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a broad-spectrum disease-resistant bio-control Bacillus velei and its application. The Bacillus velezensis strain BCP6 (Bacillus velezensis) was deposited in the China General Microorganism Culture Collection and Management Center on May 15, 2019, with the preservation number CGMCC No.17805. Bacillus Bellis of the present invention has significant inhibitory effect to lettuce bacterial soft rot and sclerotinia, simultaneously to Botrytis cinerea ( Botrytis cinerea ), Fusarium solani ( Fusarium solani ), Fusarium oxysporum ( F. oxysporum ), Penicillium ( Penicillium sp.) and Rhizoctonia solani ( Rhizoctonia solani ) and other plant pathogenic fungi and watermelon acidophilus ( Acidovorax citrulli ), Pseudomonas syringae ( Pseudomonas syringae ), Xanthomonas oryzae (X anthomonas oryzae ), Ralstia solanacearum ( Ralstonia solanacearum ) and Pseudomonas marginalia ( P. marginalis ) and other plant pathogenic bacteria also exhibited broad-spectrum antibacterial activity. At the same time, the Bacillus Velez exhibits salt-alkaline tolerance and has important application prospects in biocontrol.

Description

technical field [0001] The invention belongs to the field of microorganisms, specifically relates to the field of biological control, and more specifically relates to Bacillus Velez and its application. Background technique [0002] Because lettuce is rich in nutrients such as protein, sugar and vitamins, it is widely cultivated all over the world and is favored by consumers. , Wang Yubin, Zhao Xiaoyan, Zhang Chao. The effect of LED light treatment on the quality and flavor of fresh-cut lettuce [J]. Modern Food Science and Technology, 2019, 35(5):1-8.), taking Beijing as an example, it is also a sowing One of the largest green leafy vegetables (Lei Xihong, Li Wei, Sun Chaohua, Li Xinxu, Feng Ying, Wang Yanfang. Vegetable factory production (8) High-quality lettuce hydroponic production technology [J]. Chinese Vegetables, 2019 (02) :87-91.). Common diseases of lettuce in the cultivation process include sclerotinia, bacterial soft rot, etc., which have brought serious losses...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01N63/22A01P3/00A01P1/00A01G13/00A01G7/06C12R1/07
CPCA01N63/00A01G13/00A01G7/06C12R2001/07C12N1/205A01N63/10
Inventor 谢华陈昌龙田宇孙旺旺
Owner BEIJING AGRO BIOTECH RES CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com