Method for Improving Color Sorting Accuracy of Rice Genetic Engineering Male Sterile Line Seeds by Utilizing Dominant Black Glue Trait

A genetic engineering and nuclear sterile line technology, applied in the field of rice genetic engineering nuclear sterile line seed color sorting accuracy, can solve the problem of reducing the intensity of fluorescent proteins, hindering the promotion and application of third-generation hybrid rice, and interfering with the color sorting of color sorters Accuracy and other issues, to achieve the effect of solving insufficient color sorting accuracy, improving purity, and ensuring purity

Active Publication Date: 2021-04-02
HUNAN HYBRID RICE RES CENT +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the process of using the existing fluorescence sorting technology to separate the sterile line seeds, because the rice endosperm is wrapped by the glume, the intensity of fluorescence emitted by the fluorescent protein from the endosperm to the outside of the glume is reduced, which interferes with the color sorting of the color sorter. Accuracy, the genetically engineered male sterile line selected often contains a few seeds of the breeding line with genetically modified components
Since the public is very sensitive to genetically modified products and the country has not released restrictions on genetically modified products, if a few seeds of the reproductive line carrying genetically modified ingredients are mixed with the seeds of the sterile line during the seed production process, it will result in the production of hybrid seeds containing A small number of seeds carry genetically modified ingredients, which seriously hinders the promotion and application of third-generation hybrid rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for Improving Color Sorting Accuracy of Rice Genetic Engineering Male Sterile Line Seeds by Utilizing Dominant Black Glue Trait
  • Method for Improving Color Sorting Accuracy of Rice Genetic Engineering Male Sterile Line Seeds by Utilizing Dominant Black Glue Trait
  • Method for Improving Color Sorting Accuracy of Rice Genetic Engineering Male Sterile Line Seeds by Utilizing Dominant Black Glue Trait

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] A method for improving the color-sorting accuracy of rice genetically engineered male sterile line seeds by utilizing the dominant black chaff trait, the procedure can be found in figure 1 , including the following steps:

[0051] (1) Cultivation of Huangying double-color selection genetically engineered male sterile line with PTC1 gene mutation:

[0052] 1.1. Rice PTC1 gene encodes PHD zinc finger protein, which is a key gene regulating tapetum development and pollen formation. Mutations in the PTC1 gene will lead to abortion of rice pollen and produce a genetically engineered male sterile line. According to the cDNA sequence (Seq1) of PTC1 gene, double target sites were designed and target site linker primers Seq2 and Seq3 were synthesized.

[0053] Seq1 (SEQ ID NO.1):

[0054] cgttgattggcagcaactagctagctcgccgtccggccggccggccatggcgcctaagatggtgatcagcctggggagctcgcggcggcggaagcgcggcgagatgctgttccggttcgaggccttctgccagcccggctacccggcgaacttcgccggcgccggcggcttcagggacaacgtgaggacg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for increasing color sorting precision of nucleic sterile line seeds of rice heredity engineering through dominant black glume traits. The method specifically comprises the steps of breeding yellow glume dual color sorting heredity engineering nucleic sterile line; transmitting four chain expression genes including a dominant black glume gene, a fertility restorergene, a pollen inactivation gene and a fluorescence labeling gene into a yellow glume dual color sorting heredity engineering nucleic sterile line genome for breeding a black glume dual color sortingheredity engineering propagation line; enabling the black glume dual color sorting heredity engineering propagation line and the yellow glume dual color sorting heredity engineering nucleic sterile line to be planted in a mixed manner, and collecting all seeds in a mixed manner; performing screening on the seeds collected in a mixed manner according to the color of glumes for the first time, and separating yellow glume sterile line seeds from black glume seeds; and performing screening for the second time according to whether endosperm emits fluorescence or not, and refining the yellow glume sterile line seeds. According to the method disclosed by the invention, the dominant black glumes of rice are used as a new color sorting marker, the purity of the heredity engineering nucleic sterileline seeds in the sorting process is increased, and the purpose of enabling the purity of the heredity engineering nucleic sterile line to reach the production and application standard is realized.

Description

technical field [0001] The invention relates to the technical field of rice genetic engineering, in particular to a method for improving the color sorting accuracy of rice genetically engineered male sterile line seeds by utilizing the dominant black glume trait. Background technique [0002] The breeding and sorting of genetically engineered male sterile lines is the core technology of the third-generation hybrid rice, and the batch breeding of genetically engineered sterile line seeds and endosperm fluorescence sorting technology have been realized (see patent ZL201210426678. The industrialization of engineering nuclear sterile lines laid the foundation. However, in the process of using the existing fluorescence sorting technology to separate the CMS seeds, because the rice endosperm is wrapped by the glume, the intensity of fluorescence emitted by the fluorescent protein from the endosperm to the outside of the glume is reduced, which interferes with the color sorting of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/46A01H1/02
CPCA01H1/02C12N15/8213C12N15/8261
Inventor余东袁定阳段美娟李新奇李莉孙志忠孙学武谭炎宁盛夏冰袁贵龙袁隆平
OwnerHUNAN HYBRID RICE RES CENT