Targeted targeting vector, and method and application for targetedly integrating foreign gene to 22nd position of mouse F4/80 exon to construct BAC clone

A technology for targeting vectors and foreign genes, which can be applied to other methods of inserting foreign genetic materials, using vectors to introduce foreign genetic materials, vectors, etc., and can solve problems such as difficulties

Pending Publication Date: 2020-03-31
THE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In gene targeting technology, in order to ensure the efficiency of homologous recombination, long-segment homology arms are required, but it is difficult to directly clone long-segment homology arms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Targeted targeting vector, and method and application for targetedly integrating foreign gene to 22nd position of mouse F4/80 exon to construct BAC clone
  • Targeted targeting vector, and method and application for targetedly integrating foreign gene to 22nd position of mouse F4/80 exon to construct BAC clone
  • Targeted targeting vector, and method and application for targetedly integrating foreign gene to 22nd position of mouse F4/80 exon to construct BAC clone

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Construction of a targeting vector that integrates a foreign gene into exon 22 of mouse F4 / 80

[0032] The mouse F4 / 80 genome sequence was retrieved and downloaded from the genome.ucsc.edu website, combined with the mouse F4 / 80 (Genbank No: NM_010130.4) sequence, the positions and sequences of each exon and intron were determined. The BAC Clone containing the entire F4 / 80 gene: RP23-212F14 was purchased from the Children’hospotal Oakland Research Institute, and the BAC DNA was used HiPure Plasmid Filter Maxiprep Kit (Invitrogen) was prepared for use.

[0033]The target gene fragment F4 / 80 3' side homology arm (F4 / 80 3HA) was amplified by PCR: using RP23-212F14 BACDNA as a template, using the forward primer F4 / 80-3HA-F(BglII)-ACCACC AGATCT AACAATGTCTGAAGATTGTAAGTGC (SEQ ID NO.1), reverse primer F4 / 80-3HA-R(NotI)-AACAAC GCGGCCGC TGTACCGTTGAAATAGGACGTG (SEQ ID NO.2) was used for PCR amplification of the 3' side homology arm F4 / 80 3HA (SEQ ID NO.3). The und...

Embodiment 2

[0048] Example 2: Targeted integration of exogenous genes into mouse F4 / 80BAC using targeting vectors

[0049] Transform pRed / ET into Escherichia coli BAC Clone RP23-212F14 containing the entire F4 / 80 gene by electroporation: inoculate the Escherichia coli BAC Clone RP23-212F14 containing the entire F4 / 80 gene in chloramphenicol (15 μg / mL) LB plates were incubated at 37°C for 16h. Pick one clone and put it in a 2mL centrifuge tube with 1mL LB medium (containing 15 μg / mL chloramphenicol) (a hole is poked in the lid to allow ventilation), and cultivate overnight at 37°C and 200rpm. Take 30 μL of Escherichia coli clone cultured overnight and place it in a 2 mL centrifuge tube with 1.4 mL of LB medium (containing 15 μg / mL chloramphenicol), at 37°C and 1000 rpm, and culture for 2-3 hours to amplify the E. coli in logarithmic phase. The amplified Escherichia coli was centrifuged at 11000rpm at 2°C for 30s, and the supernatant was discarded. The Escherichia coli pellet was washed 3...

Embodiment 3

[0052] Example 3: Screening and identification of BAC clones with targeted integration of exogenous genes into mouse F4 / 80 exon 22

[0053]Colony PCR screening targeting Escherichia coli BAC Clone inserted into IRES-DTR-PGK-EM7-Neo: pick 12 single clones and place them in 1.5mL centrifuge tubes with 10μl ddH2O, and mix them by pipetting. Take 1 μl of bacterial liquid as a template, and use forward primer F4 / 80-189503-F-TGAAATAACCCAGACACAGAGTTT (SEQ ID NO.15) and reverse primer IRES screen-R-CGGCAATATGGTGGAAAATAACA (SEQ ID NO.16) for colony PCR. Add the remaining bacterial solution to a 15mL centrifuge tube containing 5mL LB medium (containing 15μg / mL chloramphenicol, 15μg / mL neomycin), and culture at 220rpm at 37°C for 16h. pRed / ET will be lost at 37°C.

[0054] The colony PCR reaction system is as follows:

[0055]

[0056] The colony PCR reaction conditions were as follows:

[0057]

[0058] The PCR product was identified by 1% agarose gel electrophoresis, and the E....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the technical field of biology and discloses a targeted targeting vector, and a method and an application for targetedly integrating a foreign gene to a 22nd positionof a mouse F4 / 80 exon to construct BAC clone. A sequence of the targeted targeting vector is shown as SEQ ID NO.14 and named as a vector F4 / 80 5HA-IRES-DTR-PGK-EM7-Neo-F4 / 80 3HA. The present inventionprovides a new site sequence capable of achieving targeted integrating, the site can be used to construct the targeting vector for inserting the foreign gene, the targeting vector is verified to be capable of efficiently integrating the foreign gene into the mouse F4 / 80 BAC clone F4 / 80 exon 22th site, and the subsequently obtained targetedly inserted foreign gene F4 / 80 BAC can be used to construct mouse embryonic stem cells with the targetedly inserted foreign gene, thereby establishing a foundation for constructing a transgenic cell line and mice.

Description

technical field [0001] The invention belongs to the field of biotechnology, and mainly relates to a targeted targeting carrier and a method for constructing a BAC clone at the 22 site of mouse F4 / 80 exon by targeting and integrating an exogenous gene and its application. Background technique [0002] Through homologous recombination, the exogenous gene is site-directedly integrated into a certain site on the genome of the target cell, so as to achieve the purpose of site-specific modification and transformation of a gene on the chromosome. This technology is called gene targeting technology. The use of gene targeting technology to target and integrate foreign genes into specific chromosomal sites has important application value in gene therapy, cell engineering, genetic animal models, gene function research and drug development, etc., and all these applications rely on the one hand. The reliability and predictability of the function of the transferred gene, on the other hand...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/90
CPCC12N15/8509C12N15/907C12N2800/204C12N2800/107C12N2840/203
Inventor盛剑鹏汤江辉白雪莉梁廷波
OwnerTHE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE