Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of procambarus clarkii anti-lipopolysaccharide factor galf1 gene, its encoded galf1 protein and its application

A technology for resisting lipopolysaccharide factor and Crayfish, which can be applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as economic loss, disease is not good, death, etc., and achieve strong inhibitory effect and inhibit replication level. Effect

Active Publication Date: 2022-02-15
HUAZHONG AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above-mentioned diseases are very fatal to the cultivation of shrimps. Once the cultivated shrimps get sick, it will cause a large area of ​​death. At present, there is no good treatment for the above-mentioned diseases. Therefore, once the shrimps cultivated by farmers get sick, it will cause huge economic loss

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of procambarus clarkii anti-lipopolysaccharide factor galf1 gene, its encoded galf1 protein and its application
  • A kind of procambarus clarkii anti-lipopolysaccharide factor galf1 gene, its encoded galf1 protein and its application
  • A kind of procambarus clarkii anti-lipopolysaccharide factor galf1 gene, its encoded galf1 protein and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0059] Preparation of gALF1 protein

[0060] ①RNA extraction and reverse transcription:

[0061] Three Crayfish were selected, blood was drawn for dissection and tissue samples were taken: hemolymph, heart, liver, gill, stomach and intestine, and total RNA was obtained by TRIzol method. The RNA purity and concentration were detected by Nano-Drop 300, and the total RNA quality was analyzed by agarose gel electrophoresis and Bio-Rad gel imager; cDNA was synthesized by reverse transcription according to the reverse transcription instructions.

[0062] ② ALF1 full-length coding region gene amplification:

[0063] using upstream primers

[0064] Pc-ALF1-EcoR I: 5'(TACTCA GAATTCCAGGTCCTGGAGGGTCTG)3';

[0065] downstream primer

[0066] Pc-ALF1-Xhol I: 5'(TACTCA CTCGAGCTACCCATCAAGCCATGCCT)3'.

[0067] The cDNA obtained by reverse transcription was used as a template for PCR amplification; a 25 μL PCR reaction system was established. The reaction conditions were: pre-denaturation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discovers a Procambarus clarkii anti-lipopolysaccharide factor gALF1 gene for the first time, and the nucleotide sequence of the gALF1 gene is SEQ ID NO.1. The present invention utilizes the gene code to prepare a gALF1 protein, and the amino acid sequence of the gALF1 protein is SEQ ID NO.2. The present invention also provides the application of the above-mentioned genes and proteins in the fields of immunity and treatment of WSSV virus infection. The invention has effective antiviral effect, has extremely strong inhibitory and killing effects on WSSV virus, and can effectively solve the problems of immunity and treatment of WSSV virus infection.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an anti-lipopolysaccharide factor gALF1 gene of Crayfish, the gALF1 protein encoded by the gene, and applications thereof. Background technique [0002] Crayfish, also known as red crayfish or freshwater crayfish, is shaped like a shrimp and has a hard carapace; the adult length is about 5.6 to 11.9 cm. Crayfish is a freshwater economical shrimp, popular for its delicious meat. Because of its omnivorous nature, fast growth and strong adaptability, it has formed an absolute competitive advantage in the local ecological environment. Its feeding range includes aquatic plants, algae, aquatic insects, animal carcasses, etc. In recent years, Crayfish has become an important economic breed in my country with huge output. [0003] White spot syndrome in prawns is a syndrome caused by the white spot syndrome baculovirus complex. The white spot syndrome baculovirus complex main...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/70C12N15/66
CPCC07K14/43509C12N15/70
Inventor 兰江风张英豪李通曹晓彤殷成明顾泽茂
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com