Method for improving PCR (polymerase chain reaction) amplification efficiency
A technology of amplification efficiency and reaction system, which is applied in the direction of biochemical equipment and methods, microbe determination/inspection, etc., can solve the problems of low PCR amplification efficiency, low PCR sensitivity, and unsatisfactory amplification products, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] The target sequence of the test is NCBI accession number NG_007992.1, which is the internal reference gene of actin. The outward primers for the first amplification are 5'ACCGCCGAGACCGCGTCCGC, as shown in SEQ ID 01, and 3'GTTGTCGACGACGAGCGCGGC, as shown in SEQ ID 02. The amplification conditions are initial denaturation at 95°C for 2 minutes, the first cycle stage is denaturation at 95°C for 35 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 30 seconds, 18 cycles of amplification, and last extension at 72°C for 5 minutes, 16°C to restore. The primers for the second amplification are 5'GTGCAGAGCCGCCGTCTGG (inward to left), as shown in SEQ ID 03, and 5'GCAGGAAGTGCGCGCAAGCGCC (inward to right), as shown in SEQ ID 04. The second cycle stage is denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 30 seconds, 18 cycles of amplification, and finally extension at 72°C for 5 minutes, and recovery at 16°C.
[0023] A comm...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com