Unlock instant, AI-driven research and patent intelligence for your innovation.

Method and kit for simultaneously constructing sequencing library by DNA and RNA

A technology for sequencing libraries and kits, applied in biochemical equipment and methods, chemical libraries, combinatorial chemistry, etc., can solve the problems of incomplete transposase inactivation, low interruption efficiency, and impact on the quality and speed of library construction.

Active Publication Date: 2020-05-12
VAZYME BIOTECH NANJING
View PDF2 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, for DNA and RNA library construction at the same time, the RNA is generally mixed with DNA after reverse transcription and second-strand synthesis, and then the library is constructed through the normal DNA library construction process. The details are as follows: figure 1 As shown (taking 8 hours), that is, the traditional DNA library construction and RNA library construction are both for specific nucleic acid library construction, and it is impossible to build a real DNA and RNA library together. This method has a long operation process, cumbersome steps, and consumes very long
[0007] The key step for simultaneous construction of DNA and RNA libraries is the transposase breaking step. The efficiency of Tn5 transposase breaking cDNA hybrid strands is low, and the inactivation of the transposase is not complete during the termination reaction, and the transposase sticks to the DNA. On the other hand, affecting the subsequent amplification will have a greater impact on the quality and speed of library construction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for simultaneously constructing sequencing library by DNA and RNA
  • Method and kit for simultaneously constructing sequencing library by DNA and RNA
  • Method and kit for simultaneously constructing sequencing library by DNA and RNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Embodiment 1: the acquisition of mutant Tn5 transposase

[0067] The preparation method of the mutant Tn5 transposase whose amino acid sequence is shown in SEQ ID NO.1 comprises the following steps: Utilize the method of gene synthesis to synthesize the primer sequence comprising the site to be mutated and the substituted base as follows:

[0068] D24-f: CGGCGCTGGGTGAGCCTCGCCGTA

[0069] D24-r: TACGGCGAGGCTCACCCCAGCGCCG

[0070] A97-f: GCCATTGAGGAAACCACCT;

[0071] A97-r: AGGTGGTTTCCTCAATGGC;

[0072] K160-f: TGCGGATGAAAGGGAGAGTGGCAA

[0073] K160-r: TTGCCACTCTCCCTTTCATCCGC

[0074] C326-f: CGGATCGACGAGTTCCATA;

[0075] C326-r: TATGGAACTCGTCGATCCG;

[0076] Phanta Max Super-Fidelity DNA Polymerase (produced by Nanjing Nuoweizan Biotechnology Co., Ltd., Vazyme, product number P505) was used as the DNA polymerase. The amplification conditions were 95°C for 30s; 95°C for 15s; 60°C for 15s; 72°C for 30s-3min; 72°C for 5min; a total of 30 cycles. After amplification,...

Embodiment 2

[0078]Example 2: DNA / RNA rapid common library construction based on mutant Tn5 transposase

[0079] The core of the present invention lies in the rapid joint library construction of DNA / RNA. The reverse transcriptase used in this example is HiScript III Reverse Transcriptase (Product No. R302) of Nanjing Novizan Biotechnology Co., Ltd.; the reverse transcription reaction buffer used is Nanjing The buffer solution attached to HiScript III Reverse Transcriptase from Novizyme Biotechnology Co., Ltd.; the reverse transcription primer used is Oligo(dT) 20 Mixture of VN and random primers; Tn5 transposase is the mutant of D24E, D97E, K160R and E326D simultaneous mutation, ie: TTE-plus. The breaking buffer is the TTBL component in the TruePrep DNA library Prep Kit V2 for Illumina kit of Nanjing Nuoweizan Biotechnology Co., Ltd., that is, TruePrep Tagment Buffer L; breaking stop buffer 5×TS-plus, containing: 2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT; RNA purification magnetic beads a...

Embodiment 3

[0145] Example 3: DNA / RNA rapid common library construction based on mutant Tn5 transposase without intermediate purification

[0146] The core of the present invention lies in the rapid joint library construction of DNA / RNA. The reverse transcriptase used in this example is HiScript III Reverse Transcriptase (Product No. R302) of Nanjing Novizan Biotechnology Co., Ltd.; the reverse transcription reaction buffer used is Nanjing The buffer solution attached to HiScript III Reverse Transcriptase from Novizyme Biotechnology Co., Ltd.; the reverse transcription primer used is Oligo(dT) 20 VN; Tn5 transposase is a mutant of simultaneous mutation of D24E, D97E, K160R and E326D, namely: TTE-plus. The breaking buffer is the TTBL component in the TruePrepDNAlibrary Prep Kit V2 for Illumina kit of Nanjing Nuoweizan Biotechnology Co., Ltd., that is, TruePrep TagmentBuffer L; breaking stop buffer 5×TS-plus, containing: 2.5% BSA, 1 % Tween-20, 0.5% SDS, 25mMDTT. DNA purification magnetic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and a kit for simultaneously constructing a sequencing library by DNA and RNA. The method comprises the following steps: (1) carrying out reverse transcription on RNAin a reaction substrate to form RNA / cDNA composite double strands; (2) directly adding Tn5 transposase and a fragmentation buffer solution into a mixture of a reverse transcription product cDNA / RNA composite double strand and a DNA double strand for fragmentation, and adding a part of linker sequence to the 5' end of the double strands during fragmentation; (3) strand displacement and library amplification: adding an amplification buffer solution and a strand displacement and amplification enzyme mixture into the obtained product, and carrying out PCR amplification; and (4) carrying out magnetic bead purification to obtain a sequencing library of the original DNA / RNA. According to the method, the library building steps are greatly reduced, the library building time is shortened, the library output and offline data quality is improved, and more real information is helped to be obtained.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method and a kit for simultaneously constructing a sequencing library from DNA and RNA. Background technique [0002] High-throughput sequencing technology, also known as second-generation sequencing technology, can be abbreviated as NGS, which refers to the technology of sequencing hundreds of thousands to several million DNA molecules in parallel at a time, and the length of the sequence is generally short. [0003] High-throughput sequencing mainly includes the following processes: sample collection and nucleic acid extraction, target sequence enrichment and sequencing library construction, sequencing and result analysis. The library construction includes DNA library construction and RNA library construction. [0004] DNA library construction generally involves randomly interrupting the DNA, adding an A linker after the end is repaired, and performing PCR amplification and qual...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C40B50/06C12N9/12
CPCC12N9/1241C40B50/06
Inventor 韩锦雄江明扬张力军聂俊伟瞿志鹏吴恒
Owner VAZYME BIOTECH NANJING