Application of exosome miRNA in preparation of lung cancer early diagnosis kit, and lung cancer early diagnosis detection kit
A detection kit and early diagnosis technology, applied in the field of medical biology, can solve the problems of low sensitivity, serious physical injury to patients, and not enough specificity, and achieve the effect of ultra-high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] This Example 1 provides the following (a)-(d) application of any one or more of exosomal miRAN in the preparation of products for early diagnosis of lung cancer:
[0057] (a) miR-30a-3p;
[0058] (b) miR-30e-3p;
[0059] (c) miR-10b-5p;
[0060] (d) miR-15b-5p.
[0061] The nucleotide sequence of miR-30a-3p is: cuuucagucggauguuugcagc (SEQ ID NO. 1); the nucleotide sequence of miR-30e-3p is: cuuucagucggauguuuacagc (SEQ ID NO. 2); the nucleoside of miR-10b-5p The acid sequence is: uacccuguagaaccgaauuugug (SEQ ID NO. 3); the nucleotide sequence of miR-15b-5p is: uagcagcacaucaugguuuaca (SEQ ID NO. 4).
[0062] MiR-30a-3p, miR-30e-3p, miR-10b-5p and miR-15b-5p can be applied to the detection of lung tumors, especially non-small cell lung tumors, including adenocarcinoma and squamous cells cancer. Among them, miR-30a-3p and miR-30e-3p are used for the detection of adenocarcinoma, and miR-10b-5p and miR-15b-5p are used for the detection of squamous cell carcinoma. MiR-30a-3p, miR-30e...
Embodiment 2
[0064] This embodiment provides a detection kit for early diagnosis of lung cancer. The kit includes miR-30a-3p, miR-30e-3p, miR-10b-5p and miR-15b-5p; the base of miR-30a-3p The base sequence is shown in SEQ ID NO.1; the base sequence of miR-30e-3p is shown in SEQ ID NO.2; the base sequence of miR-10b-5p is shown in SEQ ID NO.3 ; The base sequence of miR-15b-5p is shown in SEQ ID NO.4.
[0065] The kit also includes a first specific DNA probe for detecting miR-30a-3p. The base sequence list of the first specific DNA probe is shown in SEQ ID NO. 5; for detecting miR-30e-3p The second specific DNA probe, the base sequence list of the second specific DNA probe is shown in SEQ ID NO.6; the third specific DNA probe for detecting miR-10b-5p, the third specific The base sequence list of the sexual DNA probe is shown in SEQ ID NO.7; the fourth specific DNA probe for detecting miR-15b-5p, and the base sequence list of the fourth specific DNA probe is shown in SEQ ID. Shown in NO.8.
[0...
experiment example
[0068] Patient and sample collection
[0069] From January 2017 to February 2018, 16 patients (10 men and 6 women) with non-small cell lung adenocarcinoma and 16 patients with non-small cell lung squamous carcinoma were selected to be diagnosed early by existing means (9 males and 7 females) sera were used as the experimental group. Another 16 healthy people (9 men and 7 women) were selected as the control group.
[0070] Detection method
[0071] 1. Separation and purification of serum exosomes obtained from peripheral blood
[0072] 1. Take 2 mL of peripheral blood sample in a coagulation tube, and let it stand at room temperature for 30 minutes to coagulate the blood;
[0073] 2. Centrifuge at 10,000 rpm for 10 minutes, and transfer the supernatant to a new tube;
[0074] 3. Centrifuge the supernatant for a second time, centrifuge at 12000 rpm for 10 minutes, and transfer the supernatant to another clean tube;
[0075] 4. Serum samples are stored at -80°C.
[0076] 2. Separation and p...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap