Application of exosome miRNA in preparation of lung cancer early diagnosis kit, and lung cancer early diagnosis detection kit

A detection kit and early diagnosis technology, applied in the field of medical biology, can solve the problems of low sensitivity, serious physical injury to patients, and not enough specificity, and achieve the effect of ultra-high sensitivity

Inactive Publication Date: 2020-05-19
NANJING DRUM TOWER HOSPITAL
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods have problems such as low sensitivity, insufficient specificity, and greater physical harm to patients.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of exosome miRNA in preparation of lung cancer early diagnosis kit, and lung cancer early diagnosis detection kit
  • Application of exosome miRNA in preparation of lung cancer early diagnosis kit, and lung cancer early diagnosis detection kit
  • Application of exosome miRNA in preparation of lung cancer early diagnosis kit, and lung cancer early diagnosis detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] This Example 1 provides the following (a)-(d) application of any one or more of exosomal miRAN in the preparation of products for early diagnosis of lung cancer:

[0057] (a) miR-30a-3p;

[0058] (b) miR-30e-3p;

[0059] (c) miR-10b-5p;

[0060] (d) miR-15b-5p.

[0061] The nucleotide sequence of miR-30a-3p is: cuuucagucggauguuugcagc (SEQ ID NO. 1); the nucleotide sequence of miR-30e-3p is: cuuucagucggauguuuacagc (SEQ ID NO. 2); the nucleoside of miR-10b-5p The acid sequence is: uacccuguagaaccgaauuugug (SEQ ID NO. 3); the nucleotide sequence of miR-15b-5p is: uagcagcacaucaugguuuaca (SEQ ID NO. 4).

[0062] MiR-30a-3p, miR-30e-3p, miR-10b-5p and miR-15b-5p can be applied to the detection of lung tumors, especially non-small cell lung tumors, including adenocarcinoma and squamous cells cancer. Among them, miR-30a-3p and miR-30e-3p are used for the detection of adenocarcinoma, and miR-10b-5p and miR-15b-5p are used for the detection of squamous cell carcinoma. MiR-30a-3p, miR-30e...

Embodiment 2

[0064] This embodiment provides a detection kit for early diagnosis of lung cancer. The kit includes miR-30a-3p, miR-30e-3p, miR-10b-5p and miR-15b-5p; the base of miR-30a-3p The base sequence is shown in SEQ ID NO.1; the base sequence of miR-30e-3p is shown in SEQ ID NO.2; the base sequence of miR-10b-5p is shown in SEQ ID NO.3 ; The base sequence of miR-15b-5p is shown in SEQ ID NO.4.

[0065] The kit also includes a first specific DNA probe for detecting miR-30a-3p. The base sequence list of the first specific DNA probe is shown in SEQ ID NO. 5; for detecting miR-30e-3p The second specific DNA probe, the base sequence list of the second specific DNA probe is shown in SEQ ID NO.6; the third specific DNA probe for detecting miR-10b-5p, the third specific The base sequence list of the sexual DNA probe is shown in SEQ ID NO.7; the fourth specific DNA probe for detecting miR-15b-5p, and the base sequence list of the fourth specific DNA probe is shown in SEQ ID. Shown in NO.8.

[0...

experiment example

[0068] Patient and sample collection

[0069] From January 2017 to February 2018, 16 patients (10 men and 6 women) with non-small cell lung adenocarcinoma and 16 patients with non-small cell lung squamous carcinoma were selected to be diagnosed early by existing means (9 males and 7 females) sera were used as the experimental group. Another 16 healthy people (9 men and 7 women) were selected as the control group.

[0070] Detection method

[0071] 1. Separation and purification of serum exosomes obtained from peripheral blood

[0072] 1. Take 2 mL of peripheral blood sample in a coagulation tube, and let it stand at room temperature for 30 minutes to coagulate the blood;

[0073] 2. Centrifuge at 10,000 rpm for 10 minutes, and transfer the supernatant to a new tube;

[0074] 3. Centrifuge the supernatant for a second time, centrifuge at 12000 rpm for 10 minutes, and transfer the supernatant to another clean tube;

[0075] 4. Serum samples are stored at -80°C.

[0076] 2. Separation and p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to view more

Abstract

The invention discloses an application of exosome miRNA in the preparation of a lung cancer early diagnosis kit, and a lung cancer early diagnosis detection kit. Specifically, the invention provides ause of an exosome miRNA detection reagent, an application of exosome miRNA as a detection target in the preparation of a lung cancer diagnosis kit, and an application of the reagent for detecting theexosome miRNA expression level in the preparation of a lung cancer early diagnosis kit. The exosome miRNA is adenocarcinoma-specific miR-30a-3p and miR-30e-3p and squamous cell carcinoma-specific miR-10b-5p and miR-15b-5p in non-small cell lung cancer. The real-time fluorescent PCR detection reagent for detecting the miRNA expression level comprises a specific DNA probe. The miRNA and specific DNA probe thereof described in the invention have an auxiliary role in the lung cancer early diagnosis.

Description

Technical field [0001] The present invention relates to the field of medical biotechnology, in particular to an application of exosomal miRNA in preparing an early diagnosis kit for lung cancer and an early diagnosis and detection kit for lung cancer. Background technique [0002] Lung cancer is a malignant tumor that originates from epithelial cells, and its morbidity and mortality have accounted for the first place among malignant tumors in the world, seriously endangering human health. Non-small cell lung cancer is the main type of lung cancer, accounting for about 80%-85% of the total number of clinical lung cancer cases, which mainly include adenocarcinoma, squamous cell carcinoma and large cell undifferentiated carcinoma. Lung cancer is extremely difficult to cure. On the one hand, non-small cell lung cancer is poorly sensitive to traditional chemotherapy, and on the other hand, it lacks early diagnosis methods. As a result, when most patients are diagnosed, their condition...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886
CPCC12Q1/6886C12Q2600/158C12Q2600/178
Inventor 王永生代静泓苗立云李慧李燕赵琪演欣蔡后荣
Owner NANJING DRUM TOWER HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap