Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of gamma-glutamine synthetase mutant and its application

A technology of glutamyl methylamine and synthase, applied in the field of enzyme catalysis, can solve the problems of low enzyme specific activity, product-inhibitory industrialization constraints, etc.

Active Publication Date: 2022-01-11
ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In order to solve the existing gamma-glutamine synthetase (GMAS) catalyzed to prepare L-theanine, the enzyme specific activity is low, and the industrialization constraints that easily lead to product inhibition are solved. Extensive screening by GMAS, GGT

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of gamma-glutamine synthetase mutant and its application
  • A kind of gamma-glutamine synthetase mutant and its application
  • A kind of gamma-glutamine synthetase mutant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Embodiment 1 The activity comparison of wild-type γ-glutamine synthetase

[0051] 1.1 Construction of γ-glutamine synthetase genes from two microbial sources

[0052] Whole-gene synthesis of γ-glutamine synthetase gene SEQ ID NO:2 from Methyloversatilis universalis (GenBank No. WP_008064112) and γ-glutamine synthesis from Methylovorus mays NO.9 (GenBank No. WP_008064112) Enzyme gene SEQ ID NO: 4, and restriction endonuclease sites NdeI and XhoI were designed at both ends of the gene respectively, subcloned into vector pET24a (+), and two wild-type gene recombinant plasmids pET24a-muGMAS were obtained (see figure 1 ) and pET24a-mmGMAS (see figure 2 ) were transformed into Escherichia coli expression host BL21(DE3) respectively to obtain recombinant Escherichia coli pET24a-muGMAS / BL21(DE3) and pET24a-mmGMAS / BL21(DE3).

[0053] 1.2 Shake flask fermentation of two microbial sources of γ-glutamine synthetase strains

[0054] Pick a single colony from the pET24a-muGMAS / BL...

Embodiment 2

[0062] Example 2 Construction of site-directed mutants and identification of their activity

[0063] 2.1 Construction of site-directed mutants

[0064] Using the gene sequence of SEQ ID NO: 3 as a template, the primer pairs muGMAS-152F / muGMAS-197R and muGMAS-210F / muGMAS-261R were used for PCR respectively, and two PCR products P1 and P2 were obtained by amplification respectively. The PCR primer sequences are as follows:

[0065] muGMAS-152F:

[0066] 5'-GTGACACCCTGTCTAAACCGAGCTACGACTACAAAGGTCTGTCTC-3';

[0067] muGMAS-197R:

[0068] 5'-CAGCACCCATTTTGGCGAAGGTGTAGTGGTCGCAAGAGGTCAGAGCGTCGGTCAAGGTGTAGTTGATTTCGAAC-3'.

[0069] muGMAS-210F:

[0070] 5'-GTTCGAAATCAACTACACCTTGACCGACGCTCTGACCTCTTGCGACCACTACACCTTCGCCAAAATGGGTGCTG-3';

[0071] muGMAS-261R:

[0072] 5'-CCAGTGGTAAGCCAGTTTAGACAGAGCCAGACCGGTTTTGTCAGATTTGTCTT CGAAC-3'.

[0073] 50μl PCR reaction system includes: 10ng pET24a-muGMAS plasmid template, 10pmol primer pair, 1 × KOD plus buffer, 0.2mM dNTP, 1.5mM MgSO 4 , 5...

Embodiment 3

[0087] Example 3 Synthesis reaction of L-theanine coupled with polyphosphoric acid ATP regeneration system

[0088] The reaction system is 1L, 200mM sodium glutamate, 450mM ethylamine hydrochloride, 30mM MgCl 2 , 5mM MnCl 2 , 5mM ATP, 75mM hexametaphosphoric acid, 3.5% of the polyphosphokinase production strain PET24a-cgPPK2-Mut41 / BL21 (DE3) fermentation freeze-thawed bacteria body reported in the patent document CN202010213070.0, 6.5% of the strain obtained in Example 2 Freeze-thaw pET24a-muGMAS-no21 / BL21 (DE3) cells, react at 37°C, 200rpm for 12h; add 200mM sodium glutamate, 50mM hexametaphosphate, 2.5% pET24a-muGMAS-no21 / BL21 ( DE3) Freezing and thawing the bacteria, controlling the pH to 7.0 during the reaction process, continuing the reaction for 20 hours, sampling and testing, 63.01g / L L-theanine was produced, the yield was over 90%, and the ee value of the product was greater than 99%.

[0089] In summary, the enzyme activity of the γ-glutamine synthetase mutant SEQ I...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses a γ-glutamine synthetase mutant whose amino acid sequence is SEQ ID NO: 5. Compared with the wild-type γ-glutamine synthetase, it improves the catalytic activity of sodium glutamate The enzyme activity of reacting with ethylamine to produce theanine can generate up to 63.01g / L L-theanine, the product formation rate exceeds 90%, and the product ee value exceeds 99%, which has a good prospect for industrial development and application.

Description

technical field [0001] The invention belongs to the technical field of enzyme catalysis, and specifically relates to a γ-glutamine synthetase mutant and its method for enzymatically catalyzing the condensation reaction of glutamine and ethylamine to generate L-theanine use. Background technique [0002] Theanine (Theanine) was first isolated from green tea by the Japanese scholar Yajiro Sato in 1950. It only exists in tea plants in nature, accounting for 1% to 2% of the dry weight of tea leaves. It is a free form and is the main amino acid in tea, accounting for about 50% of all free amino acids. [0003] [0004] Theanine is necessary for the human body, but it cannot be synthesized in the human body and depends on external supply. The theanine that exists in nature is all L-type, the chemical name is N-ethyl-γ-glutamine, the pure product is a white needle-like crystal, the melting point is 217-218°C, and the specific rotation [α] D=+7.7- 8.5, the molecular weight is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/00C12N15/52C12N15/70C12N1/21C12P13/04C12R1/19
CPCC12N9/93C12N15/70C12P13/04C12Y603/04012
Inventor 范文超王金刚梁岩高书良
Owner ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com