Compositions and methods for urine sample storage and DNA extraction
A urine sample and composition technology, which is applied in the field of urine sample preservation and the composition field for DNA extraction from urine samples, can solve problems such as being unsuitable for automatic processing or large-volume samples, affecting downstream PCR applications, and complex composition.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0190] The preparation of embodiment 1 urine sample preservation solution
[0191] Acetic acid-sodium acetate buffer solution (2mol / L, pH=6.0), SDS solution (10% (M / V)) and EDTA solution (0.5mol / L, pH 8.4) were mixed by volume at a ratio of 10:20:1 , to prepare a urine sample preservation solution. For example, if 310mL of solution is required, mix 100ml of acetic acid-sodium acetate buffer, 200ml of SDS solution, and 10ml of EDTA solution.
Embodiment 2
[0192] Embodiment 2: the preparation of urine sample DNA extraction reagent
[0193] For DNA extraction from urine samples, the following reagents need to be provided:
[0194]Magnetic beads: Commercial silanol magnetic beads with a particle size of 300 nm and a concentration of 50 mg / ml
[0195] Proteinase K: Commercial 20mg / ml proteinase K, diluted to 10mg / ml with deionized water
[0196] Lysis solution: first configure a solution including 5M guanidine isothiocyanate, 4% Triton X 100, 25mM Tris-HCl (pH 6.5), 10mM EDTA, then add 200% (V / V) of isopropyl to the solution alcohol and adjust its pH to 6.5. The final lysate included 1.67M guanidine isothiocyanate, 1.33% Triton X 100, 8.33mM Tris-HCl, 3.33mM EDTA, and 66.7% isopropanol (v / v) by volume of the lysate.
[0197] Wash solution I: 50 mM guanidine isothiocyanate, 50 mM Tris-HCl (pH 5.0), 100 mM NaCl, 60% ethanol and adjust its pH to 5.0.
[0198] Wash solution II: 10 mM Tris-HCl (pH 6.0) and 70% ethanol and adjust its...
Embodiment 3
[0200] Embodiment 3: verify the effectiveness of urine sample preservation reagent
[0201] Human urine samples were collected from multiple human subjects. Each urine sample is divided into two parts. The first part was added to the preservation solution prepared in Example 1 at a ratio of 10:1 (urine: storage solution), and the second part was added with an equal amount of sterile deionized water as a control group. All samples were placed at a temperature of 37 °C for thermal acceleration experiments.
[0202] Samples were taken on day 0, day 4 and day 7. Use the urine DNA extraction reagent prepared in Example 2 to extract the DNA in the collected sample. The β-actin gene in the extracted DNA was amplified by quantitative PCR. The primer and probe sequences for detecting β-actin gene: CGTGCTCAGGGCTTCTTGTC (upstream primer, SEQ ID NO: 1), CTCGTCGCCCACATAGGAATC, (downstream primer, SEQ ID NO: 2), and 5'-FAM-TGACCCATGCCCACCATCACGCCC-3'BHQ1 (probing needle, SEQ ID NO:3). ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


