Unlock instant, AI-driven research and patent intelligence for your innovation.

Compositions and methods for urine sample storage and DNA extraction

A urine sample and composition technology, which is applied in the field of urine sample preservation and the composition field for DNA extraction from urine samples, can solve problems such as being unsuitable for automatic processing or large-volume samples, affecting downstream PCR applications, and complex composition.

Pending Publication Date: 2020-11-06
HANGZHOU NEW HORIZON HEALTH TECH CO LTD
View PDF38 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Traditional DNA extraction methods include phenol-chloroform method, salting-out method, NaI method and silica gel solid-phase carrier method, but they all have the disadvantage of complicated operation and are not suitable for automatic processing or large-volume samples
On the other hand, the composition of urine samples is relatively complex, and DNA extracted from urine samples by commonly used DNA extraction methods often contains inhibitory factors, which affect the application of downstream PCR

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions and methods for urine sample storage and DNA extraction
  • Compositions and methods for urine sample storage and DNA extraction
  • Compositions and methods for urine sample storage and DNA extraction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0190] The preparation of embodiment 1 urine sample preservation solution

[0191] Acetic acid-sodium acetate buffer solution (2mol / L, pH=6.0), SDS solution (10% (M / V)) and EDTA solution (0.5mol / L, pH 8.4) were mixed by volume at a ratio of 10:20:1 , to prepare a urine sample preservation solution. For example, if 310mL of solution is required, mix 100ml of acetic acid-sodium acetate buffer, 200ml of SDS solution, and 10ml of EDTA solution.

Embodiment 2

[0192] Embodiment 2: the preparation of urine sample DNA extraction reagent

[0193] For DNA extraction from urine samples, the following reagents need to be provided:

[0194]Magnetic beads: Commercial silanol magnetic beads with a particle size of 300 nm and a concentration of 50 mg / ml

[0195] Proteinase K: Commercial 20mg / ml proteinase K, diluted to 10mg / ml with deionized water

[0196] Lysis solution: first configure a solution including 5M guanidine isothiocyanate, 4% Triton X 100, 25mM Tris-HCl (pH 6.5), 10mM EDTA, then add 200% (V / V) of isopropyl to the solution alcohol and adjust its pH to 6.5. The final lysate included 1.67M guanidine isothiocyanate, 1.33% Triton X 100, 8.33mM Tris-HCl, 3.33mM EDTA, and 66.7% isopropanol (v / v) by volume of the lysate.

[0197] Wash solution I: 50 mM guanidine isothiocyanate, 50 mM Tris-HCl (pH 5.0), 100 mM NaCl, 60% ethanol and adjust its pH to 5.0.

[0198] Wash solution II: 10 mM Tris-HCl (pH 6.0) and 70% ethanol and adjust its...

Embodiment 3

[0200] Embodiment 3: verify the effectiveness of urine sample preservation reagent

[0201] Human urine samples were collected from multiple human subjects. Each urine sample is divided into two parts. The first part was added to the preservation solution prepared in Example 1 at a ratio of 10:1 (urine: storage solution), and the second part was added with an equal amount of sterile deionized water as a control group. All samples were placed at a temperature of 37 °C for thermal acceleration experiments.

[0202] Samples were taken on day 0, day 4 and day 7. Use the urine DNA extraction reagent prepared in Example 2 to extract the DNA in the collected sample. The β-actin gene in the extracted DNA was amplified by quantitative PCR. The primer and probe sequences for detecting β-actin gene: CGTGCTCAGGGCTTCTTGTC (upstream primer, SEQ ID NO: 1), CTCGTCGCCCACATAGGAATC, (downstream primer, SEQ ID NO: 2), and 5'-FAM-TGACCCATGCCCACCATCACGCCC-3'BHQ1 (probing needle, SEQ ID NO:3). ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The present disclosure provides compositions and methods for storing a biological sample, such as a urine sample. In addition, also provided are compositions and methods for extracting DNA from a biological sample, such as a urine sample.

Description

[0001] cross reference [0002] This application claims priority from PCT application PCT / CN2019 / 070276, filed January 3, 2019, which is incorporated herein by reference in its entirety. [0003] field of invention [0004] The present invention relates to a composition and method for preserving urine samples and extracting DNA from urine samples. [0005] Background of the invention [0006] As a convenient and simple biological sample, urine has received more and more attention in the fields of molecular diagnosis and disease monitoring and treatment. In current clinical practice, the storage of urine samples mostly relies on cryogenic environments, which requires additional equipment and leads to higher costs. The present invention provides compositions and methods for storing urine samples at relatively high temperatures (eg, room temperature), thereby facilitating the storage and transportation of urine samples. [0007] Commonly used urine DNA extraction reagents and m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6806C12N15/10
CPCC12Q1/6806C12N15/1006C12Q1/708C12Q2527/119C12Q2527/125C12Q2563/143C12Q2563/155C12N15/1013G01N33/493G01N33/569G01N2333/025
Inventor 吴扬刘刚吕宁陈一友
Owner HANGZHOU NEW HORIZON HEALTH TECH CO LTD