A Male Molecular Marker of Baldfish
A technology of molecular markers and light-lipped fish, applied in biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve problems such as slow growth of light-lipped fish
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Screening of the male-specific DNA fragments of the light lip fish
[0023] Sex-associated DNA molecular markers were obtained from sex-determined male eucalyptus by AFLP-SCAR method. The specific DNA fragment of the male light lip fish is 213bp long, and its sequence is SEQ ID NO: 1:
[0024] GCTTATCTAACTCTATTCACTTATTACTTCATTCTTAGTTGTCCTATGAGTC TCGACAGCTATTTGGGGAGAAGTTTGACCGTTGAGTCCTCCTTATACGACCGT AATAAATAGATCATCGACAATGATGCTCAGCACTACTTAATTGATATCAGCAA ACCATTTTAGCAACCCTATTAGTTCTGGAGCACTCGGTCACTATTCTCGTTAG ATGA.
[0025] In order to verify that the DNA fragment only exists in the male light-lipped fish, design probes for southern hybridization, using PCR DIG Probe Synthesis Kit (Roche Company, Cat. No. 11636090910) and Digoxigenin Hybridization Detection Kit II (Roche Company, Cat. No. 11585614910) Probe labeling and Southern hybridization were performed. The length of the probe is 201bp, and the sequence is SEQ ID NO:2:
[0026] ATCTAACTCTATCACTTATTACTTCATTC...
Embodiment 2
[0028] Embodiment 2: the method for detecting male light lip fish
[0029] The primer set that is designed to be used for detecting the specific fragment that nucleotide sequence is SEQ ID NO:1 needs, and the sequence information of wherein primer is as follows:
[0030] The sequence of one upstream primer is: 5'-ATCTAACTCTATCACTTATTAC-3' (SEQ ID NO: 3);
[0031] The sequence of the downstream primer is: 5-CTAACGAGAATAGTGACCGAG-3 (SEQ ID NO: 4); the size of the target fragment amplified by the primer pair is 205bp.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

