Unlock instant, AI-driven research and patent intelligence for your innovation.

A Male Molecular Marker of Baldfish

A technology of molecular markers and light-lipped fish, applied in biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve problems such as slow growth of light-lipped fish

Active Publication Date: 2022-04-19
HUZHOU TEACHERS COLLEGE
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the overall growth rate of the light-lipped fish is relatively slow, and it takes 2 years of breeding to reach the market size of 15-20cm in body length and 100g in weight.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Male Molecular Marker of Baldfish
  • A Male Molecular Marker of Baldfish

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Screening of the male-specific DNA fragments of the light lip fish

[0023] Sex-associated DNA molecular markers were obtained from sex-determined male eucalyptus by AFLP-SCAR method. The specific DNA fragment of the male light lip fish is 213bp long, and its sequence is SEQ ID NO: 1:

[0024] GCTTATCTAACTCTATTCACTTATTACTTCATTCTTAGTTGTCCTATGAGTC TCGACAGCTATTTGGGGAGAAGTTTGACCGTTGAGTCCTCCTTATACGACCGT AATAAATAGATCATCGACAATGATGCTCAGCACTACTTAATTGATATCAGCAA ACCATTTTAGCAACCCTATTAGTTCTGGAGCACTCGGTCACTATTCTCGTTAG ATGA.

[0025] In order to verify that the DNA fragment only exists in the male light-lipped fish, design probes for southern hybridization, using PCR DIG Probe Synthesis Kit (Roche Company, Cat. No. 11636090910) and Digoxigenin Hybridization Detection Kit II (Roche Company, Cat. No. 11585614910) Probe labeling and Southern hybridization were performed. The length of the probe is 201bp, and the sequence is SEQ ID NO:2:

[0026] ATCTAACTCTATCACTTATTACTTCATTC...

Embodiment 2

[0028] Embodiment 2: the method for detecting male light lip fish

[0029] The primer set that is designed to be used for detecting the specific fragment that nucleotide sequence is SEQ ID NO:1 needs, and the sequence information of wherein primer is as follows:

[0030] The sequence of one upstream primer is: 5'-ATCTAACTCTATCACTTATTAC-3' (SEQ ID NO: 3);

[0031] The sequence of the downstream primer is: 5-CTAACGAGAATAGTGACCGAG-3 (SEQ ID NO: 4); the size of the target fragment amplified by the primer pair is 205bp.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a male molecular marker of baldfish, the nucleotide sequence of which is SEQ ID NO:1. The present invention screens and obtains a male-specific molecular marker from the bald fish, and the detection primers designed according to the molecular marker can only amplify the target band in the male individual of the bald fish, so that the molecular marker can be used to identify the bald fish The sex of the fish; the family building process for the bald-lipped fish.

Description

technical field [0001] The invention belongs to the technical field of screening fish sex molecular markers, and in particular relates to a male molecular marker of eucalyptus. Background technique [0002] The light-lipped fish (Acrossocheilus fasciatus), commonly known as freshwater grouper, belongs to Cyprinidae and Cyprinidae, and is distributed in Zhejiang, Anhui, Jiangxi, Fujian and Taiwan. The light-lipped fish lives in the torrent environment of mountain streams and the middle and upper reaches of rivers. Its body color is bright, it has high ornamental value, and its meat is tender and nutritious. It is an economic fish suitable for both natural stocking and facility farming. . [0003] In recent years, the aquaculture industry of light-lipped fish has developed rapidly, and there are more and more researches on its artificial breeding. However, the overall growth rate of the light-lipped fish is relatively slow, and it takes 2 years of breeding to reach the marke...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12Q1/6879C12N15/11
CPCC12Q1/6888C12Q1/6879
Inventor 朱俊杰刘标刘春冬陆国富
Owner HUZHOU TEACHERS COLLEGE