Zearalenone toxin degrading enzyme mutant and production strain thereof

A technology of zearalenone and mutants, applied in the field of genetic engineering and microbial transformation, can solve problems such as high cost, industrial application hindrance, low efficiency, etc., achieve the effect of reducing production cost and promoting wide application

Active Publication Date: 2021-05-07
WEIFANG KANGDIEN BIOTECH +1
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these techniques are only partially effective, cannot completely remove ZEN, and hinder industrial applications due to their high cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Zearalenone toxin degrading enzyme mutant and production strain thereof
  • Zearalenone toxin degrading enzyme mutant and production strain thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1, the synthesis of zearalenone toxin degrading enzyme H1 gene

[0036]The applicant named the zearalenone toxin degrading enzyme gene derived from Rhodococcus erythropolis as H1, its nucleotide sequence is SEQ ID NO:2, and its encoded amino acid sequence is SEQ ID NO:1. Whole gene synthesis was carried out by Huada Gene Company.

Embodiment 2

[0037] Example 2, Screening of Zearalenone Degrading Enzyme H1 Mutant

[0038] In order to further improve the specific enzyme activity of zearalenone degrading enzyme H1, a large number of mutations were screened for the gene of the enzyme by directed evolution technology; using zearalenone toxin degrading enzyme H1 as a template, primer 1 (F ) and primer 1 (R) were amplified by PCR with GeneMorph II Random Mutation PCR Kit (Stratagene);

[0039] Primer 1 (F): GCGC GAATTC ATGACTGAAGAAGGTACTAGATCTG;

[0040] Primer 1 (R): TAAA GCGGCCGC TTAATCGTTAACTGGCAAAGTAGCA.

[0041] Gel recovery of PCR products, Eco RI, not I was subjected to enzyme digestion and connected to the pET21a vector after the same enzyme digestion, transformed into Escherichia coli BL21 (DE3), spread on LB+Amp plate, and cultured upside down at 37°C; when the transformants appeared, pick them one by one with a toothpick Transfer to a 96-well plate, add 150 ul of LB+Amp medium containing 0.1mM IPTG to...

Embodiment 3

[0047] Example 3, Construction of Pichia pastoris engineering bacteria expressing recombinant zearalenone toxin degrading enzyme

[0048] 1. Construction of recombinant plasmids

[0049] The cloned zearalenone toxin-degrading enzyme gene H1 and the mutant genes H1-T1 and H1-T2 were respectively treated with restriction endonuclease Eco R I and not I perform double enzyme digestion, 100 μl enzyme digestion system is as follows: zearalenone toxin degrading enzyme gene H1 (H1-T1, H1-T2) PCR product 40 μl, 10×H buffer 10 μl, 10×BSA 10 μl , Eco R I 5μl, not I 5 μl, ddH 2 O 30 μl. After digestion at 37°C for 4 h, the cells were recovered by agarose gel electrophoresis.

[0050] The expression vector pPIC9K was first treated with restriction endonuclease Eco R I was digested with a single enzyme, and the 100 μl enzyme digestion system was as follows: expression vector pPIC9K 20 μl, 10×H buffer 10 μl, Eco R I 5 μl, ddH 2 O 65 μl. After digestion at 37°C for 4 h, the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of gene engineering, and particularly provides a zearalenone toxin degrading enzyme mutant and a production strain thereof. Compared with a wild type, mutants H1-T1 and H1-T2 are subjected to recombinant expression in pichia pastoris, the specific enzyme activity is improved by 75.1% and 172.2% respectively, the production cost of the enzyme is reduced, and application and popularization of the enzyme in the field of feed are promoted.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and microbial transformation, and specifically relates to a zearalenone-degrading enzyme mutant and a production strain thereof. Background technique [0002] Mycotoxins (mycotoxins) are toxic secondary metabolites produced by molds during the growth process, mainly including aflatoxin (AF), trichothecenes (such as T-2 toxin, Fusarium solani NEO and DON), zearalenone (ZEN), ochratoxin A (ochratoxinA, OTA) and fumonisins (fumonisins), etc. Grain and other raw materials will be contaminated by mold in the field. If the ambient temperature and humidity are suitable during transportation, processing, and storage, the mold will continue to grow and the toxin content will increase one after another. According to the estimates of the Food and Agriculture Organization of the United Nations (FAO), 25% of the world's grains are polluted by mycotoxins every year, and an average of 2% are inedibl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/18C12N15/55C12N15/81C12N15/54C12N1/19C12R1/84
CPCC12N9/18C12N15/815C12N9/1029
Inventor 李宾程斯达康丽华张静静郭瑞黄亦钧李玉强
Owner WEIFANG KANGDIEN BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap