Method and apparatus for performing a real-time colorimetric nucleic acid amplification assay
A nucleic acid, colorimetric technology for performing and monitoring real-time colorimetric nucleic acid amplification assays
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Bacterial cells resuspended in PBS buffer were lysed at 95°C for 1 min. The Salmonella invasion gene invA was targeted by a set of six primers, two outer primers (F3 and B3), two inner primers (FIP and BIP) and two loop primers (Loop-F and Loop-B).
[0057] FIP: GACGACTGGTACTGATCGATAGTTTTTCAACGTTTCCTGCGG
[0058] BIP: CCGGTGAAATTATCGCCACACAAAACCCACCGCCAGG
[0059] F3: GGCGATATTGGTGTTTATGGGG
[0060] B3:AACGATAAACTGGACCACGG
[0061] Loop F:GACGAAAGAGCGTGGTAATTAAC
[0062] Loop B: GGGCAATTCGTTATTGGCGATAG
[0063] A total volume of 25 μl of LAMP reagent mix containing 12.5 μl of standards or colorimetric WarmStart 2×Master Mix (New England BioLabs) (which uses phenol red as the color substance), 1.8 μM of FIP and BIP, 0.1 μM of F3 and B3, 0.4 Lyse cells with μM Loop-F and Loop-B and 1 μl in PBS. Reactions are placed in such as Figure 3-4 The reaction tubes in the setup shown are performed. Monitoring of the assay was performed by recording images of the contents o...
Embodiment 2
[0065] The images obtained from Example 1 were processed as follows.
[0066] First, a sequence of images of the liquid phase is acquired as described above. The raw red (R), green (G) and blue (B) channels from the camera can be subjected to image processing including, for example, gamma correction, color adjustments, and the like. Second, extract red, green, and blue channel data from one or more pixels of each image.
[0067] In the third step, for each red, green and blue channel, for each time point, the initial values of the red, green and blue channels are subtracted to give the zero-based data. The value being subtracted can be the red, green or blue value at the first time point respectively, although usually the values from multiple initial time points can be averaged, or the curve can be plotted and the time zero axis calculated and subtracted intercept.
[0068] Next, calculate the difference between the two channels. In the following example scheme using p...
Embodiment 3
[0073]This example illustrates a second set of results from comparing positive (infected / Salmonella present) samples to negative (uninfected / Salmonella absent) samples using the image processing of Example 2. The colored substance used in such cases is phenol red. Images of the liquid phase were recorded as a function of time as the assay progressed. Computes the difference between the green and blue channels.
[0074] Figure 6 a shows the Figure 3-4 Real-time colorimetric LAMP detection of Salmonella cells (positive vs. negative samples) was performed in reaction tubes placed in the setup shown. The pressure exerted by the tube on the heating element is 0.4 MPa. The change in color of the positive curve starts at 23 minutes. The maximum color change (color index units) measured at 30 minutes was 17 units.
[0075] Figure 6 b shows an example of real-time colorimetric LAMP detection of Salmonella cells (positive vs. negative samples) performed in the same manner as e...
PUM
| Property | Measurement | Unit |
|---|---|---|
| volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More