Supercharge Your Innovation With Domain-Expert AI Agents!

High-efficiency mutant taq DNA polymerase with a terminal added and its encoding DNA

Active Publication Date: 2022-07-15
武汉翌圣生物科技有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the other hand, many DNA samples collected from crime scenes are mixed with soil, sand, rotten leaves, etc., and there will be corresponding inhibitor residues during extraction; inhibitors will hinder the amplification of the target fragment and cause the amplification result to appear Loss of STR alleles or direct failure of amplification at all loci

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-efficiency mutant taq DNA polymerase with a terminal added and its encoding DNA
  • High-efficiency mutant taq DNA polymerase with a terminal added and its encoding DNA
  • High-efficiency mutant taq DNA polymerase with a terminal added and its encoding DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1 5' end ATGC plus A test

[0018] The synthetic primer sequences are as follows

[0019] locus name Primer sequence (5'-3') 5T-F TCACTCATTAGGCACCGGG 5T-R TCAACGACAGGAGCACGAT 5A-F ACCAGACACCCATCAACAGT 5A-R ATCGTTGGCAACCAGCATCG 5C-F CTCACTCATTAGGCACCGGG 5C-R CTCAACGACAGGAGCACGAT 5G-F GACCAGACACCCATCAACAGT 5G-R GATCGTTGGCAACCAGCATCG

[0020] Using the PET28a vector plasmid as a template, the target sequence was amplified by PCR, and the amplification was divided into 4 reactions, 5A-F 5A-R, 5T-F 5T-R, 5G-F 5G-R, 5C-F 5C respectively. -R4 primers are amplified. At the same time, the addition of A of the mutant Taq DNA polymerase (B-Taq) of the present invention and the wild-type Taq enzyme was compared. When the 5' end is G / C, B-Taq has no double peaks compared with wild-type Taq enzyme, and A is added completely. It shows that the efficiency of adding A of the mutant Taq enzyme is better th...

Embodiment 2

[0026] Example 2 Blood Sample Tolerance Test

[0027] Using freshly collected human blood samples as templates, Taq DNA polymerase was tested for its ability to amplify 20-plex STR loci. In order to determine the blood tolerance of B-Taq, the amount of whole blood input in each reaction is different. Take 25ul reaction as an example, and put 0 (template is 1ng / ul gDNA 1ul), 0.625ul, 1.25ul, 2ul, 2.5ul respectively. The whole blood percentages are 0, 2.5%, 5%, 8%, and 10% respectively. The present invention adopts 20-fold STR primers, referred to as STR 20-fold primers.

[0028] Synthetic STR 20-plex primer sequences

[0029]

[0030] Table 3: PCR System

[0031] component concentration 25ul system addition volume (μL) Tris-HCl (pH8.8) 1M 1 MgCl2 25mM 2.0 KCl 2M 2 dNTPs Each 10μM 0.5 STR 20-plex primers 10μM 0.5 Whole Blood Template - 0(1ng / ulgDNA 1uL),0.625,1.25,2,2.5 B-Taq 5U / ul 0.5 ddH2O - 18.5，1...

Embodiment 3

[0036] Example 3 Inhibitor humic acid tolerance test

[0037] The ability of B-Taq to amplify STR 20-plex primers was tested in PCR reactions using 1 ng / ul gDNA as template in the presence of different concentrations of humic acid. In order to determine the humic acid tolerance of B-Taq, the amount of humic acid input in each reaction was different. Taking 25ul reaction as an example, 250ng / ul humic acid was put into 0, 0.5, 1, 1.5, and 2ul respectively; The final concentration of cyanic acid is 0, 5, 10, 15, 20ng / ul.

[0038] Table 5: PCR System

[0039] component concentration 25ul system addition volume (μL) Tris-HCl (pH8.8) 1M 1 MgCl2 25mM 2.0 KCl 2M 2 dNTPs Each 10μM 0.5 STR 20-plex primers 10μM 0.5 gDNA template 1ng / ul 1 B-Taq 5U / ul 0.5 Humic acid 250ng / ul 0，0.5，1，1.5，2 ddH2O - 17.5，17，16.5，16，15.5

[0040] Table 6: Example of PCR cycling process

[0041]

[0042] Take 10ul of th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a mutant Taq DNA polymerase with high-efficiency end-adding A, the protein sequence of which is based on the wild-type Taq DNA polymerase shown in SEQ ID NO: 1 and is mutated at the following four sites: D188K, T506R, T710R and A744K. The Taq DNA polymerase mutant of the present invention significantly improves the efficiency of adding A; it can tolerate common inhibitors such as blood, humic acid and indigo; it can directly perform PCR amplification without extracting DNA samples; significantly Shorten amplification time and obtain STR test results faster.

Description

technical field [0001] The patent of the present invention relates to a high-efficiency mutant Taq DNA polymerase with A added at the end and its encoding DNA, belonging to the field of biotechnology. Background technique [0002] STR (Short Tandem Repeat) is a molecular genetic marker that exists widely in the human genome. It is a DNA sequence formed by tandem repeats of core units consisting of 2 to 6 bases. The variation in the number of core sequence repeats makes it polymorphic in the population; at the same time, it is inherited in a Mendelian manner in the same family, which has a high degree of genetic conservation; and the detection method is relatively simple. Therefore, the genetic marker is widely used in the fields of forensic individual identification, paternity testing and DNA family tree construction. [0003] Taq DNA polymerase is the first thermostable DNA polymerase isolated from Thermobacter aquaticus. Because Taq DNA polymerase has excellent thermal s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/12C12N15/54C12Q1/686
CPCC12N9/1252C12Y207/07007C12Q1/686C12Q2521/101C12Q2565/125
Inventor 黄淑云
Owner 武汉翌圣生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com