Supercharge Your Innovation With Domain-Expert AI Agents!

High-efficiency mutant Taq DNA polymerase with A added at terminal and coding DNA thereof

A polymerase and mutant technology, which can be used in the determination/inspection of enzymes, transferases, microorganisms, etc., and can solve problems such as hindering the amplification of target fragments, residues of inhibitors, and loss of STR alleles.

Active Publication Date: 2021-09-14
武汉翌圣生物科技有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the other hand, many DNA samples collected from crime scenes are mixed with soil, sand, rotten leaves, etc., and there will be corresponding inhibitor residues during extraction; inhibitors will hinder the amplification of the target fragment and cause the amplification result to appear Loss of STR alleles or direct failure of amplification at all loci

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-efficiency mutant Taq DNA polymerase with A added at terminal and coding DNA thereof
  • High-efficiency mutant Taq DNA polymerase with A added at terminal and coding DNA thereof
  • High-efficiency mutant Taq DNA polymerase with A added at terminal and coding DNA thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1 5' end ATGC plus A test

[0018] Synthetic primer sequences are as follows

[0019] locus name Primer sequence (5'-3') 5T-F TCACTCATTAGGCACCGGG 5T-R TCAACGACAGGAGCACGAT 5A-F ACCAGACACCCATCAACAGT 5A-R ATCGTTGGCAACCAGCATCG 5C-F CTCACTCATTAGGCACCGGG 5C-R CTCAACGACAGGAGCACGAT 5G-F GACCAGACACCCATCAACAGT 5G-R GATCGTTGGCAACCAGCATCG

[0020] Using the PET28a vector plasmid as a template, the target sequence was amplified by PCR. The amplification was divided into 4 reactions, respectively 5A-F 5A-R, 5T-F 5T-R, 5G-F 5G-R, 5C-F 5C -R4 amplifies the primer. At the same time, the A addition situation of the mutant Taq DNA polymerase (B-Taq) of the present invention and the wild-type Taq enzyme was compared. When the 5' end is G / C, B-Taq compared with wild-type Taq enzyme, there is no doublet, and A is added completely. It shows that the A-adding efficiency of the mutant Taq enzyme is better than th...

Embodiment 2

[0026] Example 2 Blood sample tolerance test

[0027] The ability of Taq DNA polymerase to amplify 20-fold STR loci was tested using freshly collected human blood samples as templates. In order to determine the blood tolerance of B-Taq, the amount of whole blood input in each reaction is different. Taking the 25ul reaction as an example, 0 (template is 1ng / ul gDNA 1ul), 0.625ul, 1.25ul, 2ul, 2.5ul were added respectively ; The percentages of whole blood are 0, 2.5%, 5%, 8%, and 10%. The present invention uses 20-fold STR primers, referred to as STR 20-fold primers.

[0028] Synthetic STR 20-fold primer sequence

[0029]

[0030] Table 3: PCR system

[0031] components concentration 25ul system addition volume (μL) Tris-HCl (pH8.8) 1M 1 MgCl2 25mM 2.0 KCl 2M 2 dNTP Each 10μM 0.5 STR 20 multiplex primers 10μM 0.5 whole blood template - 0(1ng / ulgDNA 1uL),0.625,1.25,2,2.5 B-Taq 5U / ul 0.5 ddH2O - 18.5，1...

Embodiment 3

[0036] Example 3 Inhibitor humic acid tolerance test

[0037] In the presence of different concentrations of humic acid, 1ng / ul gDNA was used as a template in the PCR reaction to test the ability of B-Taq to amplify STR 20 multiple primers. In order to measure the humic acid tolerance of B-Taq, the amount of humic acid input in each reaction is different. Taking the 25ul reaction as an example, 250ng / ul humic acid was added in 0, 0.5, 1, 1.5, 2ul respectively; The final concentration of phytic acid is 0, 5, 10, 15, 20ng / ul.

[0038] Table 5: PCR system

[0039] components concentration 25ul system addition volume (μL) Tris-HCl (pH8.8) 1M 1 MgCl2 25mM 2.0 KCl 2M 2 dNTP Each 10μM 0.5 STR 20 multiplex primers 10μM 0.5 gDNA template 1ng / ul 1 B-Taq 5U / ul 0.5 humic acid 250ng / ul 0，0.5，1，1.5，2 ddH2O - 17.5，17，16.5，16，15.5

[0040] Table 6: Example of PCR cycling process

[0041]

[0042] Take...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a high-efficiency mutant Taq DNA polymerase with A added at the terminal. The protein sequence of the mutant Taq DNA polymerase is obtained by mutating the following four sites on the basis of a wild Taq DNA polymerase as shown in SEQ ID NO: 1: D188K, T506R, T710R and A744K. The Taq DNA polymerase mutant disclosed by the invention has a remarkably improved efficiency for A addition, can tolerate common inhibitors such as blood, humic acid and indigo blue, and can directly perform pCR amplification without DNA sample extraction, so that the amplification time is obviously shortened, and the STR detection result can be obtained more quickly.

Description

technical field [0001] The patent of the present invention relates to a mutant Taq DNA polymerase with high-efficiency terminal addition of A and its coding DNA, which belongs to the field of biotechnology. Background technique [0002] STR (Short Tandem Repeat) is a molecular genetic marker widely present in the human genome. It is a DNA sequence formed by tandem repeats of core units consisting of 2 to 6 bases. The change in the number of core sequence repeats makes it polymorphic in the population; at the same time, it is inherited in the same family in a Mendelian manner, with a high degree of genetic conservation; and the detection method is relatively simple. Therefore, the genetic marker is widely used in the fields of forensic individual identification, paternity identification and DNA family tree construction. [0003] Taq DNA polymerase is the first thermostable DNA polymerase isolated from aquatic thermophilic bacteria. Because Taq DNA polymerase has excellent t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/54C12Q1/686
CPCC12N9/1252C12Y207/07007C12Q1/686C12Q2521/101C12Q2565/125
Inventor 黄淑云
Owner 武汉翌圣生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com