Application of GT1/HB13 gene in regulation and control of non-degeneration and lodging resistance of inferior flower of corn ear

A lodging-resistant, 1.GT1 technology, applied in the field of maize genetics and breeding, can solve the problems of small number of filaments, abnormal development of floret carpel in female ears, etc.

Pending Publication Date: 2022-05-06
SOUTH CHINA AGRI UNIV +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Chinese patent CN111909936A discloses that after the HD-ZIP I subfamily gene Grassy tillers1 (GT1) mutation in maize, the carpels in the tassel florets of the plant do not degenerate and grow filaments, but the number of filaments is not much, indicating that the ear floret carpels Developmental abnormalities, and the impact of simultaneous mutations of GT1 and its homologous gene HB13 on maize traits has not been reported in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of GT1/HB13 gene in regulation and control of non-degeneration and lodging resistance of inferior flower of corn ear
  • Application of GT1/HB13 gene in regulation and control of non-degeneration and lodging resistance of inferior flower of corn ear

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Construction of CRISPR / Cas9 Transgenic Plants of Maize GT1 and HB13 Genes

[0026] 1. Method

[0027] The construction process of the CRISPR / Cas9 knockout vector for GT1 (SEQ ID NO: 1) and HB13 gene (SEQ ID NO: 2) is as follows: First, use the SnapGene Viewer software and homologous sequence alignment to design and screen GT1 / HB13 gene-specific The target sequence (sgRNA), in order to ensure the efficiency of gene editing, select two optimal target sequences for each gene:

[0028] GT1: GACGCCCCGCAAGGTGCAGCTGG (SEQ ID NO: 3),

[0029] GCTGAAGATGAAGGACAGGCTGG (SEQ ID NO: 4);

[0030] HB13: AGCAGGTCGCCGTCTGGTTC (SEQ ID NO: 5),

[0031] TCTGCAGCGGGAGCCCGAGC (SEQ ID NO: 6);

[0032] These target sequences are then introduced into the sgRNA expression cassette. Meanwhile, the human hSpCas9 sequence was used in commercial The PCR Cloning Kit kit was cloned into the pCPB vector and constructed as pCPB-ZmUbi:hSpCas9 vector. Next, pass the two sgRNA expression c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of GT1 and HB13 genes in regulation and control of non-degeneration and lodging resistance of corn female ear lower flowers. The method comprises the following steps: carrying out gene editing on two targets, namely GT1 and HB13 in corn by utilizing a CRISPR / Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated 9) technology; the result shows that compared with a wild type and two single-process materials, the phenotype of the gt1 / hb13 double-mutant plant is more violent, the tiller number is obviously increased, the root system is more developed, the cluster number is increased, new female ears grow on ear stems of main ears, multi-ear property is shown, axillary meristem at the lower part is developed into female ears without inhibition, lower flowers in the female ears are not degraded, and the yield of the gt1 / hb13 double-mutant plant is increased. After the GT1 and HB13 genes are knocked out, the heart skin of the inferior flowers continuously develops to form filaments, some inferior flowers can also form two filaments, the phenomenon of multiple filaments is shown, the inferior flowers continuously develop to form extra small grains in the later period, and it is shown that after the GT1 and HB13 genes are knocked out, a corn mutant plant can show strong female spike inferior flower non-degeneration phenotype and lodging resistance.

Description

technical field [0001] The invention relates to the technical field of maize genetics and breeding, and more specifically relates to the application of GT1 and HB13 genes in regulating the non-degeneration and lodging resistance of lower flowers of maize ears. Background technique [0002] Corn (Latin scientific name: Zea mays L.) is the crop with the highest economic value in the world. It is an important resource for both food, feed and bioenergy, and is particularly important for ensuring food security and economic development in my country. The inflorescence is the reproductive organ of the plant and the carrier of flowers and fruits. Its structure and morphological establishment directly affect the number of flowers, fruit quantity, size, and breeding system of the plant, and then affect the yield of the crop. Early studies believed that maize sex differentiation involves fine regulation of a variety of endogenous hormones, sex differentiation-related genes, external en...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82C12N15/29A01H5/00A01H5/02A01H6/46
CPCC12N15/8271C12N15/8261C12N15/8218C07K14/415Y02A40/146
Inventor王海洋李春连柳青孔德鑫王宝宝张桂森薛伟聪林婉纯邹婷
OwnerSOUTH CHINA AGRI UNIV