Preparation method and application of melanoma autologous tumor vaccine with high expression of adam-28
An ADAM-28, melanoma technology, applied in the field of vaccines, to achieve the effect of improving response, improving expression level, and obvious tumor immune prevention effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] A preparation method of a melanoma autologous tumor vaccine highly expressing ADAM-28, comprising the following steps:
[0043] S1. Construction of Venus vector carrying ADAM-28 gene:
[0044] Design a pair of specific primers with BamH1 and Xho1 restriction sites. The specific primer sequences are as follows: Primer 1 SEQ NO.1: GGATCCATGCAGCAATGGAGTCT; Primer 2 SEQ NO.2: CTCGAGTCAGACTTTTGCATTTGG; Use PCR to amplify the target fragment, Using B16 cell cDNA as a template, the ADAM-28 gene was amplified, digested with BamH1 and Xho1, and then the product was recovered; the recovered product was ligated with the Venus vector fragment double-digested by BamH1 and Xho1, and the ligated product was transformed into For the competent cells of DH10B, pick single bacteria for expansion and culture, and then carry out restriction enzyme digestion and identification to obtain the positive plasmid Venus-ADAM28. The conditions for amplifying the ADAM-28 gene using the B16 cell cDNA ...
Embodiment 2
[0058] A preparation method of a melanoma autologous tumor vaccine highly expressing ADAM-28, comprising the following steps:
[0059] S1. Construction of Venus vector carrying ADAM-28 gene:
[0060] Design a pair of specific primers with BamH1 and Xho1 restriction sites. The specific primer sequences are as follows: Primer 1 SEQ NO.1: GGATCCATGCAGCAATGGAGTCT; Primer 2 SEQ NO.2: CTCGAGTCAGACTTTTGCATTTGG; Use PCR to amplify the target fragment, Using B16 cell cDNA as a template, the ADAM-28 gene was amplified, digested with BamH1 and Xho1, and then the product was recovered; the recovered product was ligated with the Venus vector fragment double-digested by BamH1 and Xho1, and the ligated product was transformed into For the competent cells of DH10B, pick a single bacterium for expansion and culture, and then carry out enzyme digestion identification to obtain the positive plasmid Venus-ADAM28. The conditions for amplifying the ADAM-28 gene using the B16 cell cDNA as a template...
Embodiment 3
[0078] Animal experiment:
[0079] Experiment grouping: The experiment was divided into 3 groups, namely γ-ray irradiated B16 cells (Comparative Example 2), B16-Venus cells (Comparative Example 1) and B16-Adam28 cells (Example 2). C57BL / 6 mice were treated with 1 × 10 6 Each vaccine (50uL) was immunized twice, and the immunization interval was 2 weeks. Two weeks after the last immunization, mice were inoculated subcutaneously in the abdomen with 5 × 10 4 B16-F10 cells were used to observe tumor growth.
[0080] image 3 For the relationship between tumor volume and time, it can be seen that the tumor growth rate of the B16-Adam28 group is significantly lower than that of the other groups, and the difference is significant; the results show that the melanoma autologous tumor vaccine with high ADAM-28 expression disclosed in the present invention has a very good effect. Good tumor immune preventive effect.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap