Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method and application of melanoma autologous tumor vaccine with high expression of adam-28

An ADAM-28, melanoma technology, applied in the field of vaccines, to achieve the effect of improving response, improving expression level, and obvious tumor immune prevention effect

Active Publication Date: 2022-07-12
SUZHOU HEALIRNA BIOTECHNOLOGY CO LTD +1
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are very few studies on the relationship between ADAM-28 and melanoma.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of melanoma autologous tumor vaccine with high expression of adam-28
  • Preparation method and application of melanoma autologous tumor vaccine with high expression of adam-28
  • Preparation method and application of melanoma autologous tumor vaccine with high expression of adam-28

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] A preparation method of a melanoma autologous tumor vaccine highly expressing ADAM-28, comprising the following steps:

[0043] S1. Construction of Venus vector carrying ADAM-28 gene:

[0044] Design a pair of specific primers with BamH1 and Xho1 restriction sites. The specific primer sequences are as follows: Primer 1 SEQ NO.1: GGATCCATGCAGCAATGGAGTCT; Primer 2 SEQ NO.2: CTCGAGTCAGACTTTTGCATTTGG; Use PCR to amplify the target fragment, Using B16 cell cDNA as a template, the ADAM-28 gene was amplified, digested with BamH1 and Xho1, and then the product was recovered; the recovered product was ligated with the Venus vector fragment double-digested by BamH1 and Xho1, and the ligated product was transformed into For the competent cells of DH10B, pick single bacteria for expansion and culture, and then carry out restriction enzyme digestion and identification to obtain the positive plasmid Venus-ADAM28. The conditions for amplifying the ADAM-28 gene using the B16 cell cDNA ...

Embodiment 2

[0058] A preparation method of a melanoma autologous tumor vaccine highly expressing ADAM-28, comprising the following steps:

[0059] S1. Construction of Venus vector carrying ADAM-28 gene:

[0060] Design a pair of specific primers with BamH1 and Xho1 restriction sites. The specific primer sequences are as follows: Primer 1 SEQ NO.1: GGATCCATGCAGCAATGGAGTCT; Primer 2 SEQ NO.2: CTCGAGTCAGACTTTTGCATTTGG; Use PCR to amplify the target fragment, Using B16 cell cDNA as a template, the ADAM-28 gene was amplified, digested with BamH1 and Xho1, and then the product was recovered; the recovered product was ligated with the Venus vector fragment double-digested by BamH1 and Xho1, and the ligated product was transformed into For the competent cells of DH10B, pick a single bacterium for expansion and culture, and then carry out enzyme digestion identification to obtain the positive plasmid Venus-ADAM28. The conditions for amplifying the ADAM-28 gene using the B16 cell cDNA as a template...

Embodiment 3

[0078] Animal experiment:

[0079] Experiment grouping: The experiment was divided into 3 groups, namely γ-ray irradiated B16 cells (Comparative Example 2), B16-Venus cells (Comparative Example 1) and B16-Adam28 cells (Example 2). C57BL / 6 mice were treated with 1 × 10 6 Each vaccine (50uL) was immunized twice, and the immunization interval was 2 weeks. Two weeks after the last immunization, mice were inoculated subcutaneously in the abdomen with 5 × 10 4 B16-F10 cells were used to observe tumor growth.

[0080] image 3 For the relationship between tumor volume and time, it can be seen that the tumor growth rate of the B16-Adam28 group is significantly lower than that of the other groups, and the difference is significant; the results show that the melanoma autologous tumor vaccine with high ADAM-28 expression disclosed in the present invention has a very good effect. Good tumor immune preventive effect.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method and application of a melanoma autologous tumor vaccine highly expressing ADAM-28. The ADAM-28 gene is amplified from B16 cells by a PCR method, and cloned into a lentiviral vector to construct a recombinant lentivirus. B16-F10 cells were infected with recombinant lentivirus to obtain a melanoma cell line highly expressing ADAM-28, and after inactivation by irradiation, a melanoma autologous tumor vaccine was obtained. The present invention prepares a melanoma cell line highly expressing ADAM-28 for the first time, and thereby prepares a melanoma autologous tumor vaccine. Through a mouse tumor model, it was verified that the vaccine efficiently activates CD8 + The T cell immune response has obvious tumor immune preventive effect, so it can be used in the field of preparing tumor immune preventive drugs, especially melanoma.

Description

technical field [0001] The invention relates to the technical field of vaccines, in particular to the preparation and application of a melanoma autologous tumor vaccine highly expressing ADAM-28. Background technique [0002] Melanoma is a skin cancer caused by malignant transformation of melanocytes. It is mainly caused by ultraviolet (UV)-induced DNA mutation. It mostly occurs in the skin, but occasionally in mucous membranes and internal organs. It has the characteristics of high invasiveness and easy recurrence. . Melanoma is the third most common skin cancer, and the incidence of melanoma is rising rapidly and is one of the cancers with the highest incidence. Among them, metastatic melanoma is highly lethal and is the most deadly skin cancer. Immune system mainly through CD8 + T cells mediate cytotoxic T lymphocyte (CTL) effects to kill tumor cells. The T cell response process depends on the directional movement and immune recognition of cells. Integrins are importa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/00A61P35/00C12N15/57C12N15/867C12N5/10
CPCA61K39/001158A61K39/00119A61P35/00C12N9/6491C12N15/86C12N5/0693A61K2039/5156A61K2039/876C12N2740/15043C12N2510/00
Inventor 赵李祥冯天云易诚葛友桢胡洪鹏蒋剑豪钟天翼
Owner SUZHOU HEALIRNA BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com