Expression factor mutated baculovirus expression vector system
An expression vector and baculovirus technology, applied in the field of baculovirus expression vector system, can solve the problem of low yield of foreign protein and achieve the effect of improving expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0021] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention, but not to limit the present invention.
[0022] The following is an example of the LEF-10 truncated mutant expression cassette located on the transfer vector plasmid (attached below). figure 1 A), the application principle of the present invention is described in detail.
[0023] 1. Clone the GFP reporter gene on the transfer vector plasmid.
[0024] Amplify the eGFP gene with the primers tataccatggtgagcaagggcgagga and ggtgctcgagcttgtacagctcgtccatgc with restriction endonuclease sites, and then clone the eGFP gene into the pTriEx1.1 transfer vector plasmid between the NcoI and XhoI sites to obtain the pTriEx-GFP plasmid. .
[0025] 2. Clone the LEF-10 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


