Gene detection reagent kit for SARS virus and its detection method

A SARS virus and genetic detection technology, applied in the field of genetic detection kits, can solve problems such as unfavorable epidemic control

Inactive Publication Date: 2005-02-09
THE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current clinical diagnostic criteria can only be diagnosed after the SARS patient becomes ill or even becomes seriously ill.
This is obviously not conducive to controlling the epidemic

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene detection reagent kit for SARS virus and its detection method
  • Gene detection reagent kit for SARS virus and its detection method
  • Gene detection reagent kit for SARS virus and its detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0113] The genetic detection kit of preferred SARS virus, comprises the partial sequence of SARS virus-specific nucleic acid quantitative standard substance namely SARS:

[0114] 5'-TACCGTAGACTCAATCTCTATGATGGGTTTCAAAATGAATTACCAAGTCA

[0115] ATGGTTACCCTAATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCG

[0116] TGCGTGGATTGGCTTTGATGTAGAGGGCTGTCATGCAACTAGAGATGCTGT

[0117] GGGTACTAACCTACCTCTCCAGCTAGGATTTTCTACAGGTGTTAACTTAGTA

[0118] GCTGTACCGACTGGTTATGTTGACACTGAAAATAACCAGAATTCACCAGA

[0119] GTTAATGCAAAACCTCCACCAGGTGACCAGTTTAAACATCTTATACC-3' and

[0120] (1) Fluorescence amplification detection reagent: It is made by mixing the following components with distilled water as solvent:

[0121] The one-step RT-PCR buffer is:

[0122] 50mM potassium chloride (KCl), 10mM Tris-Cl, 25mM magnesium chloride (MgCl2), 0.1% g / ml polyethylene glycol 6000, 0.1% 1,4-dimercaptothreitol (DTT), 1% g / ml Bovine serum albumin (BSA) deoxynucleoside triphosphate (dNTP mixture) is:

[0123] 200 μM dATP, 2...

Embodiment 2

[0150] The gene detection kit of preferred SARS virus, comprises SARS virus-specific nucleic acid quantitative standard as embodiment 1, also includes:

[0151] (1) Fluorescence amplification detection reagent: It is made by mixing the following components with distilled water as solvent:

[0152] The one-step RT-PCR buffer is:

[0153] 500mM potassium chloride (KCl), 100mM Tris-Cl, 25mM magnesium chloride (MgCl 2 ), 0.1% g / ml polyethylene glycol 6000, 0.1% 1,4-dimercaptothreitol (DTT), 1% g / ml bovine serum albumin (BSA). Deoxynucleoside triphosphate (dNTP mixture) is: dATP:dCTP:dGTP:dTTP:dUTP=4:4:4:4:1; the concentration used is 100μM

[0154] Specific primer S1 0.45μM

[0155] Specific primer S2 0.55μM

[0156] Specific probe S3 0.2μM, R is FAM (carboxy fluorescent yellow), Q is TAMARA (tetramethyl-6 carboxyrhodamine)

[0157] (2) DNA polymerase (Taq): select Ampli TaqR DNase, 1.5 enzyme activity units / reaction (U)

[0158] (3) Uracil glycosylase (UNG): 200 enzyme acti...

Embodiment 3

[0169] The gene kit of preferred SARS virus of the present invention is compared with the similar reagent that German ARTUS company produces:

[0170] Sample No. 1 and No. 7 are blank controls;

[0171] Sample No. 2~6 selects the kit and detection method of embodiment 1 to detect the SARS standard product result of different dilution gradients;

[0172] Samples 8 to 12 were tested with SARS virus gene detection reagents from ARTUS company in Germany to detect the results of SARS standard products with different dilution gradients.

[0173] The test results are shown in Table 4, Figure 4 It can be seen that the test results of the two are basically the same:

[0174] sample

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The detection process of SARS virus of the gene detection reagent kit with rationing standard specific SARS virus nucleic acid as reference includes RNA extraction, PCR amplification and fluorescent detection. The venous blood sample, gargled liquid or respiratory tract secretion of the patient is used as the analysis sample directly, RNA of the sample is extracted as the nucleic acid template, and the template is used in fluorescent PCR amplification. The used fluorescent amplification detecting reagents includes one-step process RT-PCR buffering liquid, deoxynucleoside triphosphate (dNTP) mixture, specific amplification primer and specific probe. The method of the present invention is fast and convenient in detecting SARS virus.

Description

1. Technical field [0001] The invention relates to a gene detection kit and a gene detection method for detecting whether a sample contains SARS virus by using the kit. 2. Background technology [0002] Atypical pneumonia is an acute respiratory infectious disease, which is called severe acute respiratory syndrome (Severe Acute Respiratory Syndrome, SARS) abroad, or SARS for short. It is mainly transmitted through close-range air droplets and close contact. It has an acute onset and rapid spread, and the case fatality rate exceeds 5%. Since the first case appeared in Guangdong Province of my country in November 2002, nearly 30 countries and regions in the world have been involved in just half a year, and the number of patients worldwide has reached more than 6,000, and the number of cases is still increasing. Because it is transmitted through close-range air droplets and close contact, there is currently no vaccine or specific drug, and most people are not immune to SARS. C...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/25C12Q1/68
Inventor李兰娟姜汉卿沃健儿吴南屏邵俊斌麻静明
OwnerTHE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE