Immunogenic compositions for protection against Chlamydial infection

a technology of compositions and compositions, applied in the field of immunogenic compositions for protection against chlamydia infection, can solve the problems of slow recovery, unfavorable patient infection status, and inability to effectively protect human beings, and achieve the effect of improving protection

Inactive Publication Date: 2005-03-24
MURDIN ANDREW +1
View PDF4 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0021] The present invention provides a novel approach to immunizing against Chlamydial infection based on nucleic acid immunization. It has surprisingly been found that the administration of a combination of nucleotide sequences encoding two different chlamydial proteins provides an enhanced protection efficacy.
[0028] The two vectors are used in an immunogenic composition along with any convenient pharmaceutically-acceptable carrier. As noted above, the uses of the combination of two vectors produces an enhanced protection efficacy in comparison to the individual vectors alone. Accordingly, the first and second vectors preferably are present in the immunogenic composition in amounts such that the individual protective effect of each vector upon administration to the composition to the host is not adversely affected by the other.

Problems solved by technology

For most patients, the cough persists for 2 to 6 weeks, and recovery is slow.
Based on analysis of epidemics, C. pneumoniae appears to spread slowly through a population (case-to-case interval averaging 30 days) because infected persons are inefficient transmitters of the organism.
There is not yet an effective vaccine for human C. pneumoniae infection.
However, the results are potentially confounded by the infection status of the patients, since immunoblot profiles of a patient's sera change with time post-infection.
An assessment of the number and relative frequency of any serotypes, and the defining antigens, is not yet possible.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immunogenic compositions for protection against Chlamydial infection
  • Immunogenic compositions for protection against Chlamydial infection
  • Immunogenic compositions for protection against Chlamydial infection

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0063] This Example illustrates the preparation of a plasmid vector pCA76 kDa containing the 76 kDa protein gene.

[0064] The 76 kDa protein gene was amplified from Chlamydia pneumoniae (CM1) genomic DNA by polymerase chain reaction (PCR) using a 5′ primer (5′ GCTCTAGACCGCCATGACAAAAAAACAT TATGCTTGGG 3′) (SEQ ID No: 9) and 3′ primer (5′ CGGGATCCATAGAACTTGCTGCAGCGGG 3′) (SEQ ID No: 10). The 5′ primer contains a Xba I restriction site, a ribsome binding site, an initiation codon and a sequence close to the 5′ end of the 76 kDa protein coding sequence. The 3′ primer includes the sequence encoding the C-terminal sequence of the 76 kDa protein and a Bam HI restriction site. The stop codon was excluded and an additional nucleotide was inserted to obtain an inframe C-terminal fusion with the Histidine tag. The presence of a stop codon at nucleotide 828 of the amplified sequence means that only a partial 76 kDa protein is expressed.

[0065] After amplification, the PCR fragment was using QIAqu...

example 2

[0066] This Example illustrates the preparation of a plasmid vector pCAMOMP containing the MOMP protein gene.

[0067] The MOMP protein gene was amplified from Chlamydia pneumoniae (CM1) genomic DNA by polymerase chain reaction (PCR) using a 5′ primer (5′ CCCGGATATCCCACCATGTTGCCTGTAGG GAACCCTTC 3′) (SEQ ID No: 11) and a 3′ primer (5′ GGGGTACCGGAATCTGAACTGACCAGATACG 3′) (SEQ ID No: 12). The 5′ primer contains a EcoRV restriction site, a ribosome binding site, an initiation codon and a sequence encoding the N-terminal sequence of the mature MOMP. The 3′ primer includes the sequence encoding the C-terminal sequence of the MOMP and a Kpn I restriction site. The DNA sequence encoding the leader peptide was excluded, the stop codon was excluded and an additional nucleotide was inserted to obtain an in-frame C-terminal fusion with the Histdine tag.

[0068] After amplification, the PCR fragment was purified using QIAquick™ PCR purification kit (Qiagen) and then digested with Eco RV and Kpn I a...

example 3

[0069] This Example illustrates the preparation of the eukaryotic expression vectors pCA76 kDa and pCAMOMP.

[0070] Plasmid pcDNA3.1 (−) (Invitrogen) was restricted with Spe I and Bam HI to remove the CMV promoter and the remaining vector fragment was isolated. The CMV promoter and intron A from plasmid VR-1012 (Vical) was isolated on a Spe I / Bam HI fragment. The fragments were ligated together to produce plasmid pCA / Myc-His, as seen in FIG. 2.

[0071] The Xba I / Bam HI restricted PCR fragment containing the 76 kDa protein gene (Example 1) was ligated into the Xba I and Bam HI restricted plasmid pCA / Myc-His to produce plasmid pCA76 kDa (FIG. 2).

[0072] The Eco RV / Kpn I restricted PCR fragment containing the MOMP gene (Example 2) was ligated into Eco RV / Kpn I restricted pCA / Myc-His to produce plasmid pCAMOMP (FIG. 4).

[0073] The resulting plasmids, pCA76 kDa and pCAMOMP, were transferred by electroporation into E. coli XL-1 blue (Stratagene) which was grown in LB broth containing 50 μg / ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
immunogenic compositionaaaaaaaaaa
molecular sizeaaaaaaaaaa
morphologyaaaaaaaaaa
Login to View More

Abstract

A protective immune response against Chlamydial infection is achieved by in vivo administration of an immunogenic composition comprising two vectors and a pharmaceutically-acceptable carrier therefor. One of the vectors comprises a first nucleotide sequence encoding a major outer membrane protein (MOMP) of a strain of Chlamydia, preferably C. pneumoniae, and a promoter sequence operatively coupled to the first nucleotide sequence for expression of the MOMP in the host. The other of the vectors comprises a second nucleotide sequence encoding a 76 kDa protein of a strain of Chlamydia, preferably C. pneumoniae, and a promoter sequence operatively coupled to the second nucleotide sequence for expression of the 76 kDa protein in the host. The protection efficiency which is achieved by the immunization procedure is enhanced over that attained with the individual vectors alone.

Description

FIELD OF THE INVENTION [0001] The present invention relates to immunogenic compositions for protection against disease caused by Chlamydia infection in mammals, including humans. BACKGROUND OF THE INVENTION [0002] Chlamydiae are procaryotes. They exhibit morphologic and structural similarities to gram negative bacteria, including a trilaminar outer membrane, which contains lipopolysaccharide and several membrane proteins Chlamydiae are differentiated from other bacteria by their morphology and by a unique developmental cycle. They are obligate intracellular parasites with a unique biphasic life cycle consisting of a metabolically inactive but infectious extracellular stage and a replicating but non-infectious intracellular stage. The replicative stage of the life-cycle takes place within a membrane-bound inclusion which sequesters the bacteria away from the cytoplasm of the infected host cell. [0003] Because chlamydiae are small and multiply only within susceptible cells, they were ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A61K39/118C07H21/04
CPCA61K39/118C07H21/04A61K2039/543A61K2039/53
InventorMURDIN, ANDREWDUNN, PAMELA
OwnerMURDIN ANDREW