Primer and probe sequence for detecting nucleotide fragment of shigella

Abstract

The invention relates to a PCR expanding primer and probe sequence of Shigella nucleotide section. The primer sequence includes headwaters primer SFipaHpf771 and the sequence is AAATGCGTTTCTATGGCGTGT, and down stream primer SFipaHpr863 and the sequence is the primer pair of CCCAGAGGGAGAACCAGTC, and 10 basic group expanding towards 5'end direction, 10 basic group expanding towards 3'end direction from headwaters primer, and 10 basic group expanding towards 3'end direction, and 10 basic group area range primer sequence toward 5'end expanding direction. The probe sequence includes: 10 basic groups toward 3'end direction of AGCAAATGACCTCCGCACT of SFipaHpb802, and probe sequence gained toward 5'directon expanding 10 basic group area ranges.

Description

technical field [0001] The invention relates to a primer and a probe sequence for detecting Shigella nucleotide fragments. Background technique [0002] Shigella is a common pathogenic bacterium in food, and it is the main pathogenic bacterium that causes food poisoning and foodborne diseases. All strains of Shigella have strong endotoxins, which act on the intestinal wall to increase permeability, thereby promoting the absorption of toxins. Then it acts on the central nervous system and cardiovascular system, causing a series of clinical symptoms of toxemia, such as fever, mental disturbance, and even toxic shock. Its toxin destroys mucous membrane, forms inflammation and ulcer, and presents typical dysentery with pus and blood in stool. The toxin acts on the autonomic nerves of the intestinal wall, causing intestinal dysfunction, intestinal motility ataxia and spasm, especially the most obvious rectal sphincter, resulting in symptoms such as abdominal pain and tenesmus. ...

AI Technical Summary

Problems solved by technology

The gene chip method has high detection efficiency, but the technology is immature, the false positive rate and false negative rate are difficult to control, and the cost is high, and it is still in the research stage

Ordinary PCR method is mature in technology and was first used in the detection of food-borne pathogenic bacteria. However, post-processing of PCR products is required, which can easily lead to PCR product contamination, and also has certain non-specific amplification.

Images