171 results about "Shigella sonnei Dysentery" patented technology

The present invention relates to protein-protein interactions between Shigella polypeptides and mammalian polypeptides. More specifically, the present invention relates to complexes of polypeptides or polynucleotides encoding the polypeptides, fragments of the polypeptides, antibodies to the complexes, Selected Interacting Domains (SID(R)) which are identified due to the protein-protein interactions, methods for screening drugs for agents which modulate the interaction of proteins and pharmaceutical compositions that are capable of modulating the protein-protein interactions.

The invention relates to a pathogenic microorganism DNA detection chip and the chip comprises a carrier and a nucleic acid probe on the carrier. The nucleic acid probe is provided with a target detection probe used for detecting target gene of pathogenic microorganism. The pathogenic microorganism comprises but not limits to vibrio cholerae, pathogenic escherichia coli, campylobacter jejuni, Yersinia enterocolitica, parahemolytic vibrio, salmonella, and shigella and Listeria monocytogenes. The invention also relates to a preparation method of the pathogenic microorganism DNA detection chip and provides applications of the pathogenic microorganism DNA detection chip in detection of pathogenic microorganism. Also a pathogenic microorganism DNA detection chip kit is provided.

The present invention provides a gene chip for detecting common pathogen in dairy, which comprises a solid-phase vector and an oligonucleotide probe fixed on the solid-phase vector, wherein the oligonucleotide probe includes DNA fragment or its complementary DNA or RNA sequence selected from E. sakazakii, streptococcus pyogenes, staphylococcus aureus, Klebsiella pneumoniae, Klebsiella oxytoca, Listeria monocytogenes, salmonella and 16S-23S rDNA intergenic spacer region of Bacillus cereus, as well as ipaH gene of Shigella or gyrB gene of citrobacter freundii. The invention further provides a reagent box which uses the gene chip to detect pathogen in dairy. The gene chip and the reagent box of the invention for detecting pathogen in dairy are easy to operate, highly precise and greatly repeatable.

The invention relates to a culture medium for simultaneous composite enrichment of five kinds of food-borne pathogenic bacteria, namely Salmonella, Escherichia coli, Staphylococcus aureus, Listeria monocytogenes and Shigella, and a preparation method for the culture medium. Food-borne pathogenic bacteria are a significant reason to cause food positioning, so the rapid and accurate detection of the food-borne pathogenic bacteria has an important practical significance for preventing and controlling food safety incidents. The culture medium is characterized by comprising the following components: 10.0 g of peptone, 10.0 g of sodium chloride, 9.0 g of disodium hydrogen phosphate, 1.5 g of monopotassium phosphate, 0.1 g of cholate, 0.1 mg of potassium tellurite, 1.0 g of lithium chloride, 3.0 g of glucose, 2.0 g of mannitol, 2.5 g of sodium pyruvate, 1.0 g of aesculin and 1,000 mL of distilled water, wherein the pH value is 7.1 to 7.5. The culture medium can simultaneously enrich five kinds of target pathogenic bacteria, can be used for separation and identification of target bacteria, can also be used for the molecular detection of multiple pathogenic bacteria on the same detection platform, provides technical support for a method for rapidly detecting five kinds of pathogenic bacteria in food, and meets the requirement of simultaneous detection of five kinds of food-borne pathogenic bacteria.

The invention discloses an intestinal flora maker for intestinal cancer and an application of the intestinal flora maker, and belongs to the technical fields of microorganisms and genetic engineering.The intestinal flora maker comprises megasphaera, veillenella, streptococci, bilophila sp., haemophilus, corynebacterium or Escherichia-Shigella. Through detection by the intestinal flora maker, risks of individuals suffering from intestinal cancer can be assessed, and auxiliary reference can be provided for disease diagnosis and prognosis monitoring.

The invention relates to a process for the research and development of a colon-bacillus composite and speedy chromogenic identification reagent. The process is characterized in that: 1. First, the quality control method is determined through activation identification and biochemical identification of coliform groups, salmonella, shigella and staphylococcus aureus; 2. Basic nutrients are selected according to the needs of target strains; 3. It is verified by the auxanogram method that proper nutrition environments, carbon sources, nitrogen sources, minerals, microelements, nutrilits, etc. are all necessary for the growth and breeding of microbes; without any one thereof, the microbes can not grow, metabolize and breed normally; 4. A visualization reagent, a masking reagent and a synergistic agent are selected; 5. Composite selection is conducted; 6. The feasibility of the composite selection formula is verified through tests, verifications and examinations on the indexes of a speedy chromogenic substrate, including the specificity test, the sensitivity test, the real sample inspection, the false negative and false positive strain identification, the stability test, the repeatability test, the competing strain and mixed bacterium interference test, the detection time and detection rate tests. 7. The most suitable formula is selected through a factor level orthogonal combination test.

The invention relates to a gene chip and an application, which belongs to the biological detection field. The invention designs a set of detection probes by aiming at 11 types of common infectious diarrheal disease pathogen microorganism in clinic, and the gene chip containing the set of the probe. The detection probes comprises a vibrio parahaemolyticus probe, a vibrio vulnificus, a vibrio cholera probe, a vibrio alginolyticus probe, a vibrio furnissii probe, a shigella probe, an escherichia coli probe, an aeromonas probe, a salmonella probe, a campylobacteria probe, and a proteusbacillus vulgaris probe; the above mentioned probe sequence is shown as SEQ ID No: 1-117. The gene chip and probe can detect 11 types of common infectious diarrheal disease pathogen, the detection flux is high, the specialty is strong, the sensitivity is high, and the detection is rapid and effective.

The invention relates to a salmonella and shigella joint detection kit and a detection method thereof. The kit of the invention comprises Bst DNA polymerase, buffer solution, dNTPs, betaine, magnesium sulfate, development solution, stabilizing solution and positive control; and the kit also comprises two pairs of primers, namely inner primers FIP/BIP and outer primers F3/B3 which take salmonella AgfA genes and shigella ipaH genes as target genes and are designed based on loop-mediated thermostatic amplification technology. The salmonella and shigella detection kit has the advantages of more comprehensive detection effect, high specificity and low omission factor, and is suitable for quickly detecting salmonella and shigella in physical examination of food employees.

The present invention relates to one kind of gene chip for detecting six kinds of diarrhea pathogens, and the gene chip includes solid carrier and oligonucleotide probe fixed on the carrier. The oligonucleotide probe includes DNA or cDNA segments selected from nucleotide sequences corresponding to the genomes of Shigella, haemorrhagic colibacillus, invasive colibacillus, Vibrio parahaemolyticus, Vibrio cholreae and salmonella. The said chip together with sample treating reagent, hybridizing reagent, color reagent and the specification constitutes the detection kit. The present invention has high detection efficiency and high detection accuracy.

The invention provides a genetic chip and a detection kit related to major pathogenic microorganisms causing infectious diarrhea of human beings, which are mainly specific to 13 types of bacteria including lapactic bacillus coli/shigella, salmonella, comma bacillus, vibrio parahemolyticus, aeromona hydrophila, plesiomonas, virio hollisae, vibrio fluvialis, vibrio mimicus, Wauter's strains, vibriodamsela and vibrio furnissii. The genetic chip comprises a solid-phase carrier and an oligonucleotide probe fixed on the solid-phase carrier, wherein the oligonucleotide probe comprises DNA (Deoxyribonucleic Acid) fragments selected from genes including a gyrB gene, an ITS gene, a dnaJ gene, a toxR gene and the like with remarkable biological evolution advantages or complementary DNA fragments. By adopting the genetic chip and the detection kit provided by the invention, major pathogenic microorganisms causing infectious diarrhea of human beings can be detected. The genetic chip and the detection kit have the characteristics of easiness and convenience for operation, high flux, high accuracy, high repeatability and the like, and can be applied to clinical detection of inspection departments in hospitals.

The invention relates to a composite gene chip for detecting food pathogenic microbes, which comprises eight parallel sub-arrays constructed by detection probe groups for detecting each microbe in the eight food pathogenic microbes, blank lines are respectively arranged among the eight sub-arrays to be as intervals, thus constructing a big array; the eight food pathogenic microbes are listeria monocytogenes, comma bacillus, vibrio parahaemolyticus, salmonella, shigella, staphylococcus aureus, campylobacter jejuni and escherichia coli. The gene chip can clearly and accurately detect the species of eight target food pathogenic microbes, and also can definitely exclude other off-target microbe samples out of the eight target food pathogenic microbes. Each food pathogenic microbe detection sub-array on the chip can clearly and definitely distinguish off-target microbe samples from target microbe samples.

The inventive subject matter relates to a construct comprising antigens derived from multiple enterobacteria including Campylobacter jejuni capsule polysaccharide polymer, enterotoxigenic Escherichia coli recombinant polypeptide construct and lipopolysaccharide from Shigella spp. The subject invention also relates to a method of inducing an immune response utilizing the inventive composition.

The invention discloses a method by using composite fluorescence PCR technique to detect food-borne pathogenic enterobacter and pertains to bacteria detection technical field. The main technic proposal is to design a primer group sequence. The pathogenic enterobacter is common pathogenic bacteria in food and imposes a serious thread to human health. The quick and accurate detection of pathogenic enterobacter in food is a main premise condition for effective prevention and control of pathogen bacteria infection. The food-borne pathogenic enterobacter required detection mainly comprises shigella, salmonella, Yersinia enterocolitica, hemorrhagic scherichia coli and scherichia coli O157: H7. The invention overcomes technical shortage in the prior art aiming at the object bacteria and provides the quick and low-cost detection method by using composite fluorescence PCR technique to detect shigella, salmonella, Yersinia enterocolitica, hemorrhagic scherichia coli and scherichia coli O157: H7. The method can use two-diode PCR reaction and primarily screen shigella, salmonella, Yersinia enterocolitica, hemorrhagic scherichia coli and scherichia coli O157: H7.

The invention discloses a primer for detection of shigella and a detection method. The sequence of the primer for the detection of the shigella is expressed as SEQ ID NO: 1-4. The detection method for the shigella comprises the following steps of: (1) extracting DNA serving as a template; (2) adopting a loop-mediated isothermal amplification reaction system which comprises 2muL of template, 2muL of primer, 1muL of Bst DNA and 7.5 to 12.5muL of amplification reaction solution, adding water into the reaction system to obtain 25muL of reaction system, performing thermostatic reaction for 1 to 1.5 hours at the temperature of between 63 and 65 DEG C, then placing the reaction system at the temperature of 80 DEG C for 2 to 10 minutes, and terminating the reaction; and (3) observing the results, namely observing a detection tube by using naked eyes, wherein the result is positive shigella when turbid is produced, and the result is negative when no turbid is produced. The method for detecting the shigella by using the primer to perform the loop-mediated isothermal amplification reaction does not need special equipment, can quickly detect shigella dysenteriae genes in a detection sample, and has the advantages of specificity, high sensitivity and simple identification method.

The invention relates to rapid secrebil diagnosis kit for bacillary dysentery based on mediated isothermal amplification technology, and belongs to biological detection agent field. The kit comprises a set of primer, DNA polyase, reacting liquid, sample pretreating liquid, coloured solution and positive contrast liquid; said a set of promer comprises two pair of primers, and the squence is: outer primer1: ACATGAAGAGCAYGCCAACA, and Y stands for T or C; outer primer 2: TCCTCACAGCTCTCAGTGG, inner primer 1: CGGAATCCGGAGGTATTGCGTGTTTTCCTTTTCCGCGTTCCTTGA, inner primer2: GGTCGCTGCATGGCTGGAAATTTTGCAGCAACAGCGAAAGACT, and the primers comprise 2 M inner primer and 0. 25 M outer primer. The kit needs no special agent and device, can fast detect bacillary dysentery gene, and is characterized by high speciality, high sensitivity, simple determination method and high correcting rate.

The invention relates to a gene chip for detecting important pathogenic bacteria in an aquatic product and a kit thereof. The gene chip comprises a solid phase carrier and an oligonucleotide probe; the oligonucleotide probe comprises one or more of the following nucleotide sequences: (1) DNA (Deoxyribonucleic Acid) sequences selected from proteus mirabilis 1, proteus vulgaris, salmonella, vibrio parahaemolyticus, vibrio cholerae, Listeria monocytogenes, staphylococcus aureus, streptococcus pyogenes, vibrio vulnificus, bacillus cereus cluster, Shigella and pathogenic Y. enterocolitica ail gene; (2) complementary DNA sequences of the DNA sequences selected in the (1); (3) complementary RNA (Ribonucleic Acid) sequences of the DNA sequences in the (1) or (2). The kit comprises the gene chip. The gene chip and the kit can be used for detecting the important pathogenic bacteria in an aquatic product, are convenient to operate, high in precision and strong in repeatability.

The invention relates to a primer combination for detecting infectious diarrhea pathogen. The primer combination comprises at least one combination of the following combinations: a rotavirus primer combination, an enteric adenovirus primer combination, a Norovirus primer combination, a salmonella primer combination, a Shigella primer combination and a campylobacter jejuni primer combination. The invention also relates to a kit containing the primer combination. The kit also comprises a primer-coating micro-fluidic chip, an isothermal amplification reaction liquid, an isothermal amplification enzyme solution, and a negative control. The invention also relates to a detection method by using the above primer combination. The detection method comprises steps as follows: coating of the primer combination, nucleic acid extraction of a sample to be detected, LAMP reaction and result interpretation. The kit provided by the invention can detect infectious diarrhea pathogen rapidly and accurately within one hour, and is also of great significance for rapid assisted guide treatment and drug use. The multi-index detection also can be used in regional epidemiological investigation and epidemic surveillance so as to study epidemic situation of infectious diarrhea in China.

The invention relates to a dairy cow breast disinfectant, and belongs to the fields of biomedicine and medicaments for agriculture and livestock. The organic dairy cow breast disinfectant is characterized by comprising the following raw materials in percentage by mass according to the formula: 0.25 to 1 percent of 99 percent glycerol, 0.25 to 1 percent of synthetic Chinese medicinal herb concentrate, and the balance of deionized water. The Chinese medicinal herb concentrate is prepared from extracts of honeysuckle, indigowoad leaf, Chinese violet, muskroot-like semiaquilegia root, atractylodes rhizome, folium artemisiae argyi, phyllanthus ruinaria, dandelion, sophora flavescens, glabrous greenbrier rhizome, fructus cnidii, patrinia and groundsel by cleaning, extraction, re-extraction of primary residue, synthesis, decolorization and concentration, and the density of the concentrate is more than or equal to 1.04g/mm<3>. The disinfectant is used for diminishing dairy cow breast inflammation caused by invasion of multiple microbes such as candida albicans, escherichia coli, streptococcus, microsporum, salmonella and shigella and controlling invasion of pathogenic microbes on breasts and mammary glands of dairy cows.

The invention belongs to the field of traditional Chinese medicine, and relates to a traditional Chinese medicine preparation with a bacteriostasis effect, in particular to a traditional Chinese medicine preparation prepared from extracts of asian tetracera roots or leaves (roots of Tetracera asiatica(Lour.)Hoogland). Research results show that the traditional Chinese medicine preparation has a bacteriostasis activity effect on Shigella castellani, escherichia coli, staphylococcus aureus, bacillus subtilis and typhoid bacillus; good bacteriostasis and anti-inflammation effects are shown.

The invention relates to a method and a reagent for detecting the existence of shigella bacteria genus bacteria and ipaH pathogenicity island (PAI) of the shigella in clinical samples and in particular relates to the method and the eagent kit for detecting the shigella with real-time fluorescence quantitative polymerase chain reaction technique.

We describe a bacterial delivery system for the delivery of DNA and antigens into cells. We constructed an attenuated bacterial vector which enters mammalian cells and ruptures delivering functional plasmid DNA and antigens into the cell cytoplasm. This Shigella vector was designed to deliver DNA to colonic surfaces, thus opening the possibility of oral and other mucosal DNA immunization and gene therapy strategies. The attenuated Shigella is also useful as a vaccine for reducing disease symptoms caused by Shigella.