Check patentability & draft patents in minutes with Patsnap Eureka AI!

Shigella gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology

A Shigella, rapid diagnosis technology, applied in the field of biological detection reagents, can solve the problems of EB virus detection with warm amplification technology, and achieve high yield, high sensitivity, and high detection rate

Inactive Publication Date: 2007-08-01
THE SECOND PEOPLES HOSPITAL OF SHENZHEN
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are no methods and diagnostic kits for the detection of Epstein-Barr virus using the loop-mediated isothermal amplification technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1, the preparation of shigella gene rapid diagnosis kit

[0019] (1) Synthesize oligodeoxynucleic acid primers with a DNA synthesizer according to the following sequence.

[0020] Outer Primer 1:

[0021] ACATGAAGAGCAYGCCAACA (Y stands for T or C)

[0022] Outer Primer 2:

[0023] TCCTCACAGCTCTCAGTGG

[0024] Inner primer 1:

[0025] CGGAATCCGGAGGTATTGCGTGTTTTCCTTTTCCGCGTTCCTTGA

[0026] Inner primer 2:

[0027] GGTCGCTGCATGGCTGGAAATTTTGCAGCAACAGCGAAAGACT

[0028] The inner primers 1 and 2 are 2M each, and the outer primers 1 and 2 are 0.25M each.

[0029] (2) Purchase DNA polymerase: Bst DNA polymerase (Large Fragment). Put in container.

[0030] (3) Prepare reaction solution: prepare a solution containing 2mM dNTP, 25mM Tris-Cl, 12.5mM potassium chloride, 12.5mM ammonium sulfate, 10mM magnesium sulfate, 0.125% TritonX-100, and 1M betaine. For the convenience of operation, 2 M each of the inner primers 1 and 2 and 0.25 M each of the outer primers 1...

Embodiment 2

[0035] Application of Example 2 Shigella Gene Rapid Diagnostic Kit

[0036] React operation:

[0037] Sample pretreatment Shigella genomic DNA extraction process:

[0038] 1. Take 50 μl of the overnight culture enrichment solution in an eppendorf tube, centrifuge at 1000 rpm for 2 minutes, and remove the supernatant;

[0039] 2. Add 80 μl sample pretreatment solution to the centrifuge tube, and mix evenly with the bacteria obtained from the precipitation;

[0040] 3. After cooking in boiling water for 10 minutes, immediately place it on ice to cool for 10 minutes;

[0041] 4. Centrifuge at 10,000 rpm for 2 minutes, and the supernatant can be used as template DNA to be used.

[0042] The reaction process of loop-mediated isothermal amplification technology:

[0043] 1. Prepare a reaction system in a 200 μl PCR tube: 10 μl of reaction solution, 0.5 μl of Bst DNA polymerase (8U), and 2 μl of template DNA.

[0044] 2. React the prepared PCR tube at 65°C for 1.5h

[0045] Pos...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to rapid secrebil diagnosis kit for bacillary dysentery based on mediated isothermal amplification technology, and belongs to biological detection agent field. The kit comprises a set of primer, DNA polyase, reacting liquid, sample pretreating liquid, coloured solution and positive contrast liquid; said a set of promer comprises two pair of primers, and the squence is: outer primer1: ACATGAAGAGCAYGCCAACA, and Y stands for T or C; outer primer 2: TCCTCACAGCTCTCAGTGG, inner primer 1: CGGAATCCGGAGGTATTGCGTGTTTTCCTTTTCCGCGTTCCTTGA, inner primer2: GGTCGCTGCATGGCTGGAAATTTTGCAGCAACAGCGAAAGACT, and the primers comprise 2 M inner primer and 0. 25 M outer primer. The kit needs no special agent and device, can fast detect bacillary dysentery gene, and is characterized by high speciality, high sensitivity, simple determination method and high correcting rate.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a diagnostic reagent for detecting Shigella based on a loop-mediated isothermal amplification technique. Background technique [0002] At present, there are many detection methods for pathogenic microorganisms, ranging from the national standard (GB / T4789.7-2003) focusing on the isolation and identification of pathogenic microorganisms, morphological identification and automatic biochemical identification, to the immunological detection technology of specific proteins, nucleic acid Molecular biological detection methods such as probes and polymerase chain reaction (PCR) technology. Among them, the detection of pathogenic nucleic acid has great advantages in terms of rapidity, safety, accuracy and sensitivity. Separation and purification, and rapid detection of genes and gene products directly with the sample or the enrichment solution of the sample, and combined with molecular b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 徐小平肖德明王大平付林严冰李心晖杜正平陈洵石磊曹以诚
Owner THE SECOND PEOPLES HOSPITAL OF SHENZHEN
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More