Shigella gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology
A Shigella, rapid diagnosis technology, applied in the field of biological detection reagents, can solve the problems of EB virus detection with warm amplification technology, and achieve high yield, high sensitivity, and high detection rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0018] Embodiment 1, the preparation of shigella gene rapid diagnosis kit
[0019] (1) Synthesize oligodeoxynucleic acid primers with a DNA synthesizer according to the following sequence.
[0020] Outer Primer 1:
[0021] ACATGAAGAGCAYGCCAACA (Y stands for T or C)
[0022] Outer Primer 2:
[0023] TCCTCACAGCTCTCAGTGG
[0024] Inner primer 1:
[0025] CGGAATCCGGAGGTATTGCGTGTTTTCCTTTTCCGCGTTCCTTGA
[0026] Inner primer 2:
[0027] GGTCGCTGCATGGCTGGAAATTTTGCAGCAACAGCGAAAGACT
[0028] The inner primers 1 and 2 are 2M each, and the outer primers 1 and 2 are 0.25M each.
[0029] (2) Purchase DNA polymerase: Bst DNA polymerase (Large Fragment). Put in container.
[0030] (3) Prepare reaction solution: prepare a solution containing 2mM dNTP, 25mM Tris-Cl, 12.5mM potassium chloride, 12.5mM ammonium sulfate, 10mM magnesium sulfate, 0.125% TritonX-100, and 1M betaine. For the convenience of operation, 2 M each of the inner primers 1 and 2 and 0.25 M each of the outer primers 1...
Embodiment 2
[0035] Application of Example 2 Shigella Gene Rapid Diagnostic Kit
[0036] React operation:
[0037] Sample pretreatment Shigella genomic DNA extraction process:
[0038] 1. Take 50 μl of the overnight culture enrichment solution in an eppendorf tube, centrifuge at 1000 rpm for 2 minutes, and remove the supernatant;
[0039] 2. Add 80 μl sample pretreatment solution to the centrifuge tube, and mix evenly with the bacteria obtained from the precipitation;
[0040] 3. After cooking in boiling water for 10 minutes, immediately place it on ice to cool for 10 minutes;
[0041] 4. Centrifuge at 10,000 rpm for 2 minutes, and the supernatant can be used as template DNA to be used.
[0042] The reaction process of loop-mediated isothermal amplification technology:
[0043] 1. Prepare a reaction system in a 200 μl PCR tube: 10 μl of reaction solution, 0.5 μl of Bst DNA polymerase (8U), and 2 μl of template DNA.
[0044] 2. React the prepared PCR tube at 65°C for 1.5h
[0045] Pos...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com