Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

167 results about "Bacillary dysentery" patented technology

Bacillary dysentery is a type of dysentery, and is a severe form of shigellosis. Bacillary dysentery is associated with species of bacteria from the family Enterobacteriaceae. The term is usually restricted to Shigella infections.

Sulfonated derivative of andrographolide and combination of medication

The present invention discloses II kinds of andrographolide sulfonated derivatives with the actions of resisting bacteria, relieving inflammation and reducing fever and medicine composition containing them. They can be used for preparing freeze-dried powder, injection or oral preparation, and can be used for curing the diseases of pneumonia, bronchitis, tonsillitis and bacillary dysentery, etc.
Owner:JIANGZI QINGFENG PHARMACEUTICALS INC

Chinese medicinal formula for treating chronic non specific ulcer colonitis

A Chinese medicine for treating chronic non-specific ulcerative colitis, chronic enteritis, and bacillary dysentery is prepared from 23 Chinese medicinal materials including coptis root, black plum donkey-hide gelatin, Chinese angelica root, etc.. This invention prescription of traditional Chinese medicine has the advantages of short treating course, high curative effect and no side effect.
Owner:林云毅

Traditional Chinese medicine for treating bacillary dysentery

The invention belongs to the field of application of traditional Chinese medicines, and particularly discloses a traditional Chinese medicine for treating bacillary dysentery. The traditional Chinese medicine for treating bacillary dysentery is prepared from rhizoma acori tatarinowii, spica prunellae, folium isatidis, radix aucklandiae, fructus crataegi, herba polygoni avicularis, daffodil, flos sophorae, herba portulacae, shrubalthea flower, herba agrimoniae, masson pine bark, Chinese sage herb, flower of poplar, sanguisorba officinalis and flower of japanese banana according to certain weight proportions. The traditional Chinese medicine disclosed by the invention has the advantages of good absorption effect, long efficacy duration, obvious curative effect, no side effect, high safety and low production cost, and is easy to prepare and favorable for relieving the morbidity of a patient in time.
Owner:姜云华

A pueraria root scutellaria and coptis extract

The invention provides Gegenqinlian extractive which is obtained by mixing four medicines of kudzuvine roots, baikal skullcap roots, goldthread roots, and licorice roots in the weight ratio of 8: 3: 3: 2, extracting effective parts and refining. The extractive has the main effective parts in the following weight percentage: total isoflavone of the kudzuvine roots is 13.5 to 21.0 percent, total flavone of the baikal skullcap roots is 20.5 to 32.5 percent, total alkaloid of the goldthread roots is 10.5 to 18.5 percent, and glycerrhizic acid is 2.0 to 5.0 percent. Through adding medicinal auxiliary materials into the extractive, and adopting a conventional method, various peroral preparation for treating bacillary dysentery, acute enteritis, and infantile virus diarrhea can be prepared.
Owner:SOUTHERN MEDICAL UNIVERSITY

Vaccine for protection against Shigella sonnei disease

Compositions and methods for protecting a susceptable host against an infection of Shigella sonnei are disclosed. Such compositions and methods are useful for protecting the host against bacillary dysentery and shigellosis.
Owner:US DEPT OF HEALTH & HUMAN SERVICES

Antiphlogistic antiviral medicinal composition, and its preparation method and application

The invention discloses an antibacterial and antiviral drug combination, containing scutellaria total flavone and blackberry lily total flavone as active components and a routine pharmaceutical carrier. The combination has the characteristics that distinct antibacterial and antiviral functions are possessed; the healing efficacy is better than that of using scutellaria root total flavone or blackberry lily total flavone singularly; the compound combination of the effective position of traditional Chinese medicine of with better healing efficacy and convenience and the preparation thereof are supplied for clinical use; not only the pharmacological and clinical healing effect of traditional Chinese medicine is improved, but inclusion content also is reduced; diverse preparations such as peroral typed, injection typed, or external typed preparation can be made, wherein the peroral preparation is preferred. The invention has the advantages that the drug combination and the preparation thereof can be applied to the treatment of diseases such as respiratory tract infection, acute bacillary dysentery, virus hepatitis, and oral ulcer, etc.; the purposes of safety, effectiveness, stability, controllability, and convenience of a modern Chinese herbal compound are realized.
Owner:HEBEI IDEAL & HIGHTECH PHARMA

A pueraria root scutellaria and coptis medicinal composition

The invention provides Gegenqinlian medicine composition. The active ingredients of the composition consists of extractive with the following weight ratio: 40 to 86 parts of kudzuvine root extractive, 35 to 65 parts of baikal skullcap root extractive, 15 to 36 parts of goldthread root extractive, and 10 to 20 parts of licorice root extractive; the main effective parts of the four kinds of extractive respectively have the content that the kudzuvine root extractive contains 40 to 85 percent of total isoflavone of the kudzuvine roots, the baikal skullcap root extractive contains 60 to 90 percent of total flavone of the baikal skullcap roots, the goldthread root extractive contains 50 to 85 percent of total alkaloid of the goldthread roots, and the licorice root extractive contains 12 to 30 percent of glycerrhizic acid; the four kinds of extractive are obtained by respectively extracting each raw material medicine in the traditional formula, namely the Gegenqinlian formula, extracting in different ways according to the properties of the effective parts of the different medicines, and refining. The composition of the invention can be used for preparing preparation for treating bacillary dysentery, acute enteritis, and infantile virus diarrhea.
Owner:SOUTHERN MEDICAL UNIVERSITY

Shigella gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology

The invention relates to rapid secrebil diagnosis kit for bacillary dysentery based on mediated isothermal amplification technology, and belongs to biological detection agent field. The kit comprises a set of primer, DNA polyase, reacting liquid, sample pretreating liquid, coloured solution and positive contrast liquid; said a set of promer comprises two pair of primers, and the squence is: outer primer1: ACATGAAGAGCAYGCCAACA, and Y stands for T or C; outer primer 2: TCCTCACAGCTCTCAGTGG, inner primer 1: CGGAATCCGGAGGTATTGCGTGTTTTCCTTTTCCGCGTTCCTTGA, inner primer2: GGTCGCTGCATGGCTGGAAATTTTGCAGCAACAGCGAAAGACT, and the primers comprise 2 M inner primer and 0. 25 M outer primer. The kit needs no special agent and device, can fast detect bacillary dysentery gene, and is characterized by high speciality, high sensitivity, simple determination method and high correcting rate.
Owner:THE SECOND PEOPLES HOSPITAL OF SHENZHEN

Vaccine for protection against Shigella sonnei disease

Compositions and methods for protecting a susceptable host against an infection of Shigella sonnei are disclosed. Such compositions and methods are useful for protecting the host against bacillary dysentery and shigellosis.
Owner:UNITED STATES OF AMERICA

Andrographolide dispersed tablet

The invention involves andrographolide disintegrating tablet. The invention drugs uses the andrographolide as raw materials, prepares fines of andrographolide extract, adds suitable findings to making andrographolide disintegrating tablet which can collapse completely in 3 minutes and distributes uniformly, and the invention has the effects of heat clearing, detoxicating, antibiosis and anti-inflammation. It can be used for upper respiratory tract infection and bacillary dysentery. The disintegrating tablet can collapse rapid when in water to dissolving into fragrance and sweet solution, so it is easier for patients to accepting and using, and more convenient for bring and use and other features. The preferred findings in the invention can make andrographolide disintegrating tablet collapse more rapidly.
Owner:JIANGXI HERBFINE HI TECH

Orally taken traditional Chinese medicine composition for treating bacillary dysentery

InactiveCN101129672ANormal symptomsNormal bloodAntibacterial agentsDigestive systemOral medicationBacillary dysentery
The invention discloses an oral administration pharmaceutical composition for treating bacillary dysentery, which is prepared from Chinese pulsatilla root, goldthread root, corktree bark, large-leaf gentian root, dandelion, purslane, white atractylodes rhizome, root of herbaceous peony, banksia rose, honeysuckle flower, areca seed and ginseng by a finite weight ratio. The medicament should be decocted in water for the oral dose.
Owner:王莲香

Cotton leaf ethanol extract, its preparation method and use

An alcohol extract of polygonum lapathifolium includes such steps as breaking, reflux extracting in alcohol 2-3 times, collecting filtrate, vacuum concentrating, centrifugal separation to obtain supernatant, extracting in ethyl acetate 2-3 times, collecting liquid extract, vacuum concentrating, silicagel column chromatography and eluting with TLC developer. It can be used for preventing and treating cancer, and treating bacillary dysentery, enteritis, eczema, snake bite, etc.
Owner:李舜卿

Traditional Chinese medicine formula for treating diarrhea

The invention relates to a traditional Chinese medicine formula for treating diarrhea, which is characterized by comprising the following components by mass ratio: 45-55% of purslane, 25-30% of Euphorbia humifusa Willd and 25-30% of phoenix-tail fern. The medicine is prepared as follows: adding water to the three components, boiling by strong heating fire, and then boiling for 30min by slow fire. The medicine juice can be taken once respectively in the morning and evening. The purslane is cold and cool and has the efficacy of clearing heat and detoxifying, and the combined use of the Euphorbia humifusa Willd and the phoenix-tail fern can play the role of clearing heat, detoxifying and arresting diarrhea. The formula can be used for treating enteritis, bacillary dysentery and typhoid.
Owner:田升

Breeding method for pollution-free black goats

The invention discloses a breeding method for pollution-free black goats. The method includes the steps of selecting of a breeding farm; lamb selecting; lamb feeding; adult goat feeding; disease preventing and parasite expelling; cleaning and disinfecting work. According to the breeding method, natural ecological resources are completely used, no chemical substances are added, and mutton of the black goats bred through the breeding method is fresh, tender and tasty, high in quality, free of any hormone and high in safety. Sheep manure can serve as fertilizer to act on feeding substances, the feeding substances serve as feed to feed the black goats, and therefore an agricultural circular economy industry mode is achieved. Herba portulacae is added into the feed, the effects of clearing away heat and toxic materials and preventing bacillary dysentery are achieved, and herba portulacae not only can serve as edible resources of the black goats but also can achieve its own medicinal value after being added into the feed.
Owner:农祥堂

Traditional Chinese medicine for treating children's chronic bacillary dysentery

A traditional Chinese medicine for curing infantile chronic bacillary dysentery belongs to a traditional Chinese medicine for curing dysentery. The components contain: 15g of tangshen,, 12g of largehead atractylodes rhizome, 15g of tuckahoe, 5g of villous amomum fruit (finally added), 3g of common aucklandia root (finally added), 12g of old arable soil, 12g of chinese date, 20g of Chinese yam rhizome, 20g of stir-fried green bean, 15g of lotus seed and 6g of radix glycyrrhizae; the invention has the auxiliary prescriptions that: for the patients with sinking of qi of middle-jiao accompanied by prolapse of the anus, etc., 25g of milkvetch root, 8g of rhizoma cimicifugae and 6g of orange fruit are added. The substances in the prescription are made from natural traditional Chinese medicine plus traditional preparing methods. The materials are easy to collect, the prescription and the preparation methods are simple, and the cost of medicine preparation is low. The compatibility of the traditional Chinese medicine is simple; the medicine used in the prescription is fully natural herbal medicine, which is easy to collect and use; the preparation method is simple; the effects for taking and curing are good; the cost of the medicine is low, and the medicine is in particular suitable for the people living in remote villages far from towns; the cost is low for curing the people suffering from infantile chronic bacillary dysentery, which solves the problem that the local area lacks medical conditions to cure the disease because of low household income and poor living condition.
Owner:宋世洲

Traditional Chinese medicine for treating acute bacterial dysentery

The invention relates to a traditional Chinese medicine for curing acute bacillary dysentery, belonging to the traditional Chinese medicine for curing dysentery, which is composed of 30g dysentery, 6g coptis root, 10g baikal skullcap root, 30g radish seed semen raphani, 10g hyacinth-bean flower, 10g white peony root, and 6g licorice root. The auxiliary prescription is that 8g prescription and 8g honeysuckle flower are further charged if thermal heavy dysentery is down with much redness and little whiteness, 6g atractylis ovata, 6g magnolia bark, and 6g wrinkled giant-hyssop are further charged if wrinkled giant-hyssop dysentery is down with much whiteness and little redness, 10g wrinkled giant-hyssop, 10g cimicifuga rhizome, 10g bitter orange are further charged if tenesmus and anal tenesmus happen, 10g rhubarb horsetails is further charged if stool is severely not smooth, and 12g rhubarb horsetails and 12g rhubarb horsetails if dysentery is down with much pus blood. The ingredient medicine substances in the medical prescription all use natural Chinese herbal medicine, and the invention is made by the traditional processing method, and has the advantage of easy material-taken, simple ingredient and medicament method, and low medicine-medicament cost. The compatibility of the Chinese herbal medicine is simple, and the medicine in the medicine ingredient all uses natural herb, the fetching and using are convenient, the producing method is simple, the intake effect is excellent, and the price of the medicine is low, and the invention is particularly applicable to the people who live in villages far away from downtown and to the people suffering from curing acute bacillary dysentery, and the treating cost is low, which solves the problems that the household income is low, the living standard is poor, and local medical condition is lacked, and imperfect reaction during the treating process of people taking the medicine is not produced.
Owner:宋世洲

Traditional Chinese medicine for treating acute bacillary dysentery

The invention relates to a traditional Chinese medicine and especially relates to a traditional Chinese medicine for treating acute bacillary dysentery. The traditional Chinese medicine comprises 40-50g of plantain seed, 20-40g of sophora flavescens and 15-25g of scorched hawthorn fruit. The above materials are grinded together into fine powder so that the traditional Chinese medicine is obtained. 10g of the traditional Chinese medicine is taken with warm boiled water each time, three times a day. A treatment course comprises 5 days. The traditional Chinese medicine is designed according to the traditional Chinese medicine syndrome differentiation theory, has a simple formula, utilizes the easily acquired raw materials, has a low cost, high curative effects and no toxic or side effect, and can regulate the human body to a normal state.
Owner:孙冰清

Chinese patent medicine for treating bacillary dysentery

The invention provides a Chinese patent medicine for treating bacillary dysentery, which comprises 2 to 4 parts by weight of rhizome coptidis, 7 to 11 parts by weight of scutellaria baicalensis, 7 to 11 parts by weight of prepared rhubarb, 9 to 15 parts by weight of lonicera japonica, 7 to 11 parts by weight of radix paeoniae rubra, 7 to 11 parts by weight of angelica, 5 to 7 parts by weight of licorice, 5 to 7 parts by weight of costustoot and 7 to 11 parts by weight of areca catechu. Compared with the prior art, the Chinese patent medicine for treating the bacillary dysentery distinguishes distinction to treat aiming at inner disease evil of the bacillary dysentery, is rapid in curative effect and low in cost, does not have side effect, and is obvious in effect.
Owner:CHENGDU LYUDI TECH

Gastroenteritis treating Chinese medicine preparation and its preparing process

The present invention discloses a kind of Chinese medicine preparation for treating acute and chronic gastroenteritis, diarrhea, bacillary dysentery and infantile indigestion and its preparation process. The Chinese medicine preparation is capsule or oral liquid prepared with wolfs milk, goldhair hedyotis herb, camphor root, elsoltzia and maple leaf, and into the material, Chinese pulsatilla root and phellodendron bark may be also added. Compared with available syrup, the present invention has the advantages of simple preparation process, high content of effective components, stable product quality, raised curative effect, etc.
Owner:四川泰华堂制药有限公司

Traditional Chinese medicine composite for treating bacillary dysentery

The invention discloses a traditional Chinese medicine composite for treating bacillary dysentery, which comprises the following raw materials in parts by weight: 10-20 parts of ramulus cinnamomi, 5-7 parts of coptis chinensis, 4-6 parts of cortex phellodendri, 2-4 parts of processed rheum officinale, 8-10 parts of curcuma zedoary, 6-7 parts of bamboo shavings, 5-6 parts of purslane, 2-4 parts of solanum cathayanum, 5-7 parts of lespedeza cuneata, 4-5 parts of sanguisorba officinalis, 3-5 parts of codonopsis pilosula, 5-7 parts of lophatherum gracile, 3-5 parts of pericarpium granati, 2-4 parts of houttuynia cordata, 1-3 parts of rumex crispus, 3-5 parts of rodgersia pinnata, 2-3 parts of cucumber vine, 3-4 parts of hyacinth bean flower, 4-5 parts of acalypha australis, and 3-5 parts of kaki calyx. The traditional Chinese medicine composite treats inner pathogenic factors of the bacillary dysentery, is fast and good in treatment effect, and low in cost, has no toxic or side effects, and treats the bacillary dysentery basically.
Owner:黄萍

Pharmaceutical preparation for bacillary dysentery of piglets

The invention relates to a pharmaceutical preparation for bacillary dysentery of piglets. The pharmaceutical preparation comprises the following active ingredients in parts by weight: 30 parts of plantain herb, 25 parts of burdock root, 25 parts of dandelion, 22 parts of codonopsis pilosula, 20 parts of bighead atractylodes rhizome, 20 parts of radix isatidis, 20 parts of liquorice, 17 parts of cyrtomium fortunei, 17 parts of poria cocos, 15 parts of hawthorn, 15 parts of the bark of ash, 12 parts of radix bupleuri, 12 parts of medicated leaven, 10 parts of spina gleditsiae, 10 parts of rhizoma anemarrhenae, 10 parts of Chinese trumpet creeper, 8 parts of the root of Chinese pulsatilla, 7 parts of mangnolia officinalis, 5 parts of almond and 5 parts of honeysuckle. The pharmaceutical preparation is used for treating both symptoms and root causes of the bacillary dysentery of piglets and is obvious in effective rate and wide in application prospects.
Owner:河南恒野农牧股份有限公司

Fukean dispersible tablet and preparation method thereof

The invention discloses a Fukean dispersible tablet and a preparation method thereof. The tablet is prepared from the main raw materials such as herba agrimoniae, herba euphorbiae humifusae, jasminum elongatum, Chinese knotweed herb, ovateleaf holly bark, plantain herb and pomegranate rind and the accessories such as a filling agent, a disintegrating agent, a lubricating agent, a wetting agent and a sweetening agent. The preparation method comprises the following steps: carrying out decocting and extracting, filtering the extract to recycle the ethanol, concentrating the ethanol into thick paste, drying the thick paste and grinding the thick paste into extract powder; and adding micropowder of herba euphorbiae humifusae, then adding the filling agent, the disintegrating agent and the sweetening agent to be mixed uniformly, then adding the wetting agent and supercritical extract of herba agrimoniae, carrying out wet granulation, adding the lubricating agent, pressing the mixture to prepare the dispersible tablet and coating the film to prepare the Fukean dispersible tablet. The dispersible tablet has the advantages of small dispersible grain size, short disintegrating time, quick dissolution, high bioavailability, adverse effects, etc. The dispersible tablet has good effect on treating abdominal pains, diarrhea and vomit caused by acute gastroenteritis and dyspepsia and especially has better effect on treating abdominal pains and diarrhea caused by bacillary dysentery.
Owner:江西亿友药业有限公司

Chinese medicinal composition and preparation method thereof

The invention discloses a preparation method for a Chinese medicinal composition, which comprises the following steps of: mixing 456 to 2,280 weight parts of ovateleaf holly bark in 580 to 2,900 weight parts of ovateleaf holly bark, 2,280 to 11,400 weight parts of garden euphorbia herb and 1,140 to 5,700 weight parts of Chinese knotweed herb, adding deionized water in an amount which is 8 times the weight of the mixture, decocting for the first time for 2 hours and collecting decoction; adding the deionized water in an amount which is 6 times the weight of the mixture, decocting for the second time for 1 hour, collecting decoction, mixing the two-time decoction, filtering, collecting filter liquor, and concentrating to form thick paste with the density of between 1.25 and 1.30; and adding the residual weight parts of ovateleaf holly bark into the thick paste, and sieving with a 100-mesh sieve to prepare ovateleaf holly bark fine powder, namely the Chinese medicinal composition. In the preparation method, the transfer rate of medicinal active ingredients is improved to over 96 percent, and the leaching of invalid ingredients is reduced. The prepared Chinese medicinal composition has an obvious treatment effect on bacillary dysentery and acute and chronic gastroenteritis (P is less than 0.05).
Owner:史志辉 +1

Medicine for treating acute bacillary dysentery and acute enteritis

The present invention provides a medicine for curing acute bacillary dysentery and acute enteritis. Said medicine is made up by using (by weight ratio) 5-9 portions of humifuse euphorbia and 3-6 portions of verbena as main emdicinal ingredient, also adding, scutallaria root and willow-leaved smartweed as auxiliary medicinal ingredient, and can be made into any conventional oral preparation. Said medicine can obtain obvious therapeutic effect for curing bacillary dysentery, acute enteritis, urinary tract infection and hemorrhage etc.
Owner:李友良

Herbal tea and preparation method thereof

The invention relates to a herb tea drink and its preparing process, wherein the drink is prepared from the following raw materials (by weight portion): snow tea 10-20 parts, snow ginseng 25-35 parts, snow flower 5-10 parts, Japanese pachysamdra herb 5-15 parts, Xuelikai 5-15 parts, snow ganoderma lucidum 10-20 parts, snow lotus flower 1-2 parts, capilary Artemisia 10-20 parts, licorice root 5-15 parts, cogongrass rhizome 10-15 parts, white sugar 10-20 parts, bee honey 25-35 parts, murraya jasminorage 2-4 parts. The drink can be used for treating hypertension, stomach pain and bacillary dysentery.
Owner:王京

Chinese medicinal composition for preventing and treating avian bird flu diseases

The invention relates to a Chinese medicinal composition for preventing and treating avian bird flu diseases. The invention adopts the technical scheme that the Chinese medicinal composition is prepared by the following raw material drugs in portion by weight: 10 to 30 portions of tsaoko amomum fruit, 5 to 20 portions of Piper longum, 20 to 50 portions of perilla, 20 to 50 portions of balloon flower, 30 to 70 portions of fructus forsythia, 30 to 50 portions of aloe, 50 to 70 portions of radix isatidis, 30 to 50 portions of Andrographis paniculata, 30 to 60 portions of sun-plant, 30 to 60 portions of nutmeg, 50 to 70 portions of honeysuckle, and 20 to 30 portions of liquorice. The specific Chinese medicinal composition is special for preventing and treating avian bird flu. Proved by years of actual application, the Chinese medicinal composition has the following three advantages: firstly, the curative effect is obvious, and the healing rate reaches more than 97 percent; secondly, the cost is low, and the Chinese medicinal composition has the effect on preventing and treating for 3 hours; and thirdly, the bird eggs accord with export standards. The Chinese medicinal composition can resist virus, sterilize, detoxicate, reduce phlegm, treat bacillary dysentery, clear heat and purge pathogenic fire, and achieves the aims of treating both the symptoms and root causes.
Owner:FUZHOU CANGSHAN JINDIANZI INFORMATION CONSULTING

Traditional Chinese medicine for treating chronic bacillary dysentery

The invention belongs to a traditional Chinese medicine and especially relates to a traditional Chinese medicine for treating chronic bacillary dysentery. The traditional Chinese medicine is characterized by comprising 50g of pomegranate bark and 15g of Chinese angelica. The above materials are decocted in clear water and all the decoction is taken one time. The traditional Chinese medicine is designed according to the traditional Chinese medicine differentiation theory, has a simple formula, utilizes the easily acquired raw materials, and has a low cost, high curative effects and no toxic or side effect, can adjust the human body to a normal state, and can effectively treat chronic bacillary dysentery.
Owner:任振枝

Bitter gourd drug toothpaste

The invention relates to bitter gourd drug toothpaste, which is characterized by containing the following components: 18wt% to 30wt% of bitter gourd, 0.1wt% to 0.25wt% of plant antibiotic, 35wt% to 48wt% of calcium hydrophosphate, 0.1wt% to 0.4wt% of sodium pyrophosphate, 10wt% to 18wt% of sorbierite, 1wt% to 2.5wt% of sodium carboxy methyl cellulose, 1.0wt% to 2.5wt% of laurinol sodium sulfate, 0.2wt% to 0.8wt% of spice, 0.2wt% to 0.5wt% of saccharin sodium, 0.5wt% to 2wt% of hairyvein agrimonia herb and bud, and purified water which is added to 100wt%. The toothpaste has the function of cleaning teeth of the ordinary toothpaste and has the efficacies of relieving the inflammation, sterilizing, stopping bleeding, treating ulcer, eliminating halitosis, preventing cold, bacillary dysentery and bronchitis, exciting the respiratory center, relieving smooth muscle spasm, treating Meniere's syndrome and the like.
Owner:王小兵

Traditional Chinese medicinal formula for treating acute enteritis

The invention relates to a traditional Chinese medicinal formula for treating acute enteritis by oral administration. Acute enteritis often occurs in hot summer and autumn. In Western medicine, anti-inflammatory and antibacterial drugs are used for treatment of acute enteritis, but sometimes, intestinal beneficial bacterial colonies are severely killed, causing intestinal dysfunction and conversion from acute enteritis to chronic enteritis. The traditional Chinese medicinal preparation has effects of removing dampness by diuresis, clearing away heat, and invigorating spleen and stomach, and has good drug effect, low toxic and adverse effects, no drug resistance and the like. The traditional Chinese medicinal preparation comprises the following ingredients in parts by weight: 8-12 parts of Scutellaria baicalensis, 8-12 parts of Rhizoma Atractylodis (Atractylodes lancea and / or Atractylodes chinensis), 6-14 parts of Radix Puerariae (Pueraria lobata and / or Pueraria thomsonii), 5-15 parts of Nelumbo nucifera leaf, 8-12 parts of Aucklandia lappa, Pogostemon cablin, 10-20 parts of parched Dolichos lablab seed, 2-4 parts of Rhizoma Coptidis, 8-10 parts of Magnolia officinalis, 2-4 parts of processed Radix Glycyrrhizae, 9-15 parts of Angelica dahurica, 8-12 parts of Alisma orientalis, 10-20 parts of Perilla frutescens leaf, and 12-18 parts of parched Massa Medicata Fermentata. The traditional Chinese medicinal preparation has effects of clearing the bowels, relieving diarrhea, and relieving exterior and interior syndromes, and has good therapeutic effect on acute enteritis, bacillary dysentery, ileotyphus, gastrointestinal type cold and other diseases due to non-relief of exterior syndrome and intense heat. The traditional Chinese medicinal preparation takes action after 2 days of administration, and patients are clinically recovered after 3-4 days.
Owner:吕亚英