62 results about "Maple" patented technology

The invention discloses an SNP (Single Nucleotide Polymorphism) site and a KASP primer group for identifying or assisting in identifying clematis maple and application of the SNP site and the KASP primer group. The SNP site is located at the 2688th site of SEQ ID No.1 (sequence identifier number 1). The KASP primer group is composed of single-stranded DNA (deoxyribonucleic acid) as shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4. The method comprises the following steps: carrying out next-generation sequencing and assembling on clematis maple for the first time, taking formed ultra-long scaffold as a reference genome ultra-long fragment, carrying out simplified genome sequencing on 15 clematis plants, and comparing the simplified genome sequencing with the reference genome ultra-long fragment to obtain difference sites, finally, the KASP molecular marker CA24547 is developed on the basis of the difference sites, and the KASP molecular marker CA24547 is verified. The KASP molecular marker developed by the invention can realize accurate identification of the clematis nepalensis in the seedling stage, and has important significance for protecting the clematis nepalensis.

The invention provides a trichoderma maple fungicide, a microbial granular fertilizer as well as a preparation method and application of the trichoderma maple fungicide and the microbial granular fertilizer, and relates to the field of microorganisms. The acer rubrum fungicide contains acer rubrum RA with the preservation number of CGMCC No.35889. The acer rubrum fungicide has the capability of decomposing inorganic phosphorus, is wide in phosphorus dissolving range, can decompose tricalcium phosphate, ferric phosphate and aluminum phosphate, and particularly still has the very strong capability of decomposing the inorganic phosphorus under the low-temperature condition; the strain has the capability of producing siderophore and IAA at low temperature; the strain has an inhibition effect on various pathogenic bacteria causing field crop diseases. The microbial granular fertilizer provided by the invention contains various biostimulant substances, can promote crop growth, improve plant stress resistance and improve plant resistance to plant diseases and insect pests, and field tests prove that the microbial granular fertilizer can significantly promote crop growth and improve crop yield.

The invention belongs to the technical field of molecular biology, and particularly discloses a primer capable of identifying five acer species at the same time and application of the primer, the primer comprises AcerTS-F: CGGAACTAGTCGGATGGAGT; the invention relates to a method for preparing an Ac < S-R >: GAAGCAGTTCGAGACAACCG; respectively extracting total DNA (deoxyribonucleic acid) of acer palmatum, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum plants; carrying out PCR (Polymerase Chain Reaction) amplification on the total DNA (Deoxyribose Nucleic Acid) of each species by using the AcerTS-F and the AcerTS-R; after PCR products are sequenced, sequence comparison is carried out, five acer species including acer northeast, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum can be identified at the same time, and precious genetic resources are provided for genetic diversity, phylogenetic evolution and taxonomy research of the acer species.

The invention discloses an auricularia auricula strain and a rejuvenation culture medium and a cultivation method thereof, and belongs to the field of edible fungus cultivation. A new auricularia crispa strain is separated from miscellaneous trees at the top of Aoba in Nanpond village, Shixan town, eight-step area, Hexanzhou city, Guangxi Zhuang Autonomous Region, named 'Guiyun No.7', and the preservation number is GDMCC No.65145. The invention further discloses a preparation method of the auricularia crispa strain. The invention also discloses a rejuvenation culture medium which comprises the following components: 20 g / L of barks, 20 g / L of glucose, 2 g / L of yeast extract and 20 g / L of agar, and the barks are cyclobalanopsis barks or maple barks. Through the rejuvenation culture medium, the auricularia auricula strain can be rejuvenated, and strain degeneration is prevented. The crisp agaric strain can also be directly applied to cultivation and production, large-scale cultivation and production of crisp agaric are achieved, and the current situation that only a small-scale experimental research stage exists in crisp agaric cultivation at present is changed.

The invention discloses a Cladomucor racemosus and application thereof, the strain number of the Cladomucor racemosus is JSAFC 1762, the Cladomucor racemosus is preserved in China General Microbiological Culture Collection Center on December 9, 2024, and the preservation number of the Cladomucor racemosus is CGMCC No.41702. The invention further discloses a preparation method of the Cladomucor racemosus. According to the application disclosed by the invention, the soil around the sweetgum is separated and purified to obtain the mycomucor racemosus (Mucorracemosus). The strain can be used as a biocontrol strain and has inhibitory activity on trametes maze, and the inhibition rate of plate confrontation culture reaches 58.01%; meanwhile, the strain can promote the growth of liquidambar formosana hance and regulate the growth of plants, and has great significance for the development of biocontrol microbial agents for preventing and treating wood rot in the future.

This invention discloses an anti-wrinkle and soothing composition and its preparation method, belonging to the field of cosmetic technology. The composition includes the following steps: mixing and stirring a moisturizer, antioxidant, emollient, deionized water, ginseng root extract, snow lotus (SAUSSUREA INVOLUCRATA) extract, dark green agave (AGAVE ATROVIRENS) extract, umbrella maple leaf extract, and lotus coronulatus flower extract until homogeneous, thus obtaining the anti-wrinkle and soothing composition. Utilizing the synergistic effects between the components, it possesses both anti-wrinkle and soothing effects, synergistically improving skin aging problems.

The invention relates to the technical field of acer truncatum seed oil processing, in particular to an acer truncatum seed oil processing and squeezing assembly which mainly comprises a material barrel, a transmission rod is rotationally arranged in the material barrel, and a spiral oil squeezing plate is installed on the outer surface of the transmission rod; the box body is arranged below the charging barrel, at least one group of fixed frames are arranged in the box body, and filter plates are arranged at the bottom ends in the fixed frames; the scraping assembly is slidably arranged at the position, corresponding to the upper portion of the filter plate, in the box body and used for scraping impurities attached to the upper end face of the filter plate, and the scraping assembly comprises an elastically-arranged scraping plate; the acer truncatum seed oil is filtered through a filter plate, in the filtering process, a rotating transmission rod downwards presses a connecting plate through an abutting rod, the connecting plate extrudes a second air bag through an extrusion plate, air in the second air bag is exhausted into a first air bag through an exhaust pipeline, and the first air bag expands to push a guide block to move; and then an elastically-arranged scraping plate is driven to scrape the impurities, and the impurities are scraped into the storage box.

The present invention provides a practical method for preparing a chlorella culture medium, wherein anhydrous sodium acetate, soil leaching solution, jackfruit leaf extract, oxalis leaf extract, macronutrient water-soluble fertilizer and tracenutrient water-soluble fertilizer are mixed to prepare the chlorella culture medium. The chlorella culture medium of the present invention is rich in various nutrients and growth factors, can ensure the rapid growth requirements of chlorella, has a strong inhibitory effect on bacteria and parasites, can effectively reduce the contamination of miscellaneous bacteria and parasites during the chlorella culture process, and has obvious effects.

The invention discloses a tissue culture method of semiliquidambar cathayensis and belongs to the technical field of tissue culture of semiliquidambar cathayensis, the method comprises the steps of explant collection and treatment, explant disinfection, induction culture, proliferation-rooting integrated culture, seedling hardening, transplanting and the like, by improving a culture medium, proliferation-rooting integrated culture of semiliquidambar cathayensis is achieved, and the tissue culture rate of semiliquidambar cathayensis is increased. The tissue culture time is shortened, and the operation cost is reduced; the tissue culture method has the advantages that the tissue culture seedlings of the semiliquidambar cathayensis can be rapidly cultured, dry matter accumulation of the tissue culture seedlings of the semiliquidambar cathayensis is promoted, hormone level, illumination time, illumination intensity, temperature and the like are controlled, vitrification is effectively inhibited, the problem of propagation coefficient reduction caused by vitrification of the tissue culture seedlings in the tissue culture process of the semiliquidambar cathayensis is solved, and efficient tissue culture of the semiliquidambar cathayensis is realized; the method has important significance on promoting the development of the semiliquidambar cathayensis industry.

The invention discloses an automatic dehulling and seed taking system for acer palmatum seeds, the system comprises an arranging device and a cutting device, the arranging device is used for sequencing the acer palmatum seeds, the cutting device is used for cutting the sequenced acer palmatum seeds to obtain seed kernels, the cutting device comprises a material taking clamp, a cutter and a lower die, the material taking clamp is used for clamping and moving seeds, the cutter is used for cutting the seeds, and the lower die is used for positioning the seeds in the cutting process. The automatic acer palmatum seed shelling and taking system disclosed by the invention has the advantages that the production efficiency is greatly improved, the damage to the seeds is reduced, the structure is simple, the service life is long, and the like.

The utility model relates to the technical field of maple cultivation and planting, in particular to a maple cultivation stabilizing frame which comprises a first supporting frame and a second supporting frame hinged to the first supporting frame and further comprises an installation assembly. The installation assembly comprises a fixed block, a frame body, a fixed rod, a block body, a limiting plate, an adjusting screw rod, a limiting block, a movable screw rod and a driving component, the block body is fixedly installed on one side of the second supporting frame, the frame body is fixedly installed on the side, close to the block body, of the second supporting frame, the fixed rod is slidably connected with the frame body and slidably connected with the block body, and the fixed block is fixedly connected with the first supporting frame. The driving component is connected with the frame body and the fixed rod, the adjusting screw rod is in threaded connection with the first supporting frame, the limiting plate is rotationally installed on the side, close to the second supporting frame, of the adjusting screw rod, the moving screw rod is in threaded connection with the second supporting frame, and the limiting block is rotationally connected with the moving screw rod, so that the using effect of the device is improved.

The invention discloses all-traditional Chinese medicine traumatic injury medicinal liquor and a preparation method thereof, and belongs to the field of traditional Chinese medicine. The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 25-35 parts of rubus suavissimus, 35-45 parts of ventilago leiocarpa benth, 25-35 parts of fructus schisandrae chinensis, 12-18 parts of asarum sieboldii, 35-45 parts of semiliquidambar cathayensis, 35-45 parts of entada phaseoloides, 17-23 parts of kadsura pepper stem, 25-35 parts of lindera glauca, 35-45 parts of lysimachia christinae hance, 25-35 parts of angelica sinensis, 25-35 parts of berchemia lineate, 35-45 parts of oxalis, 35-45 parts of radix achyranthis bidentatae, 17-23 parts of artabotrys hexapetalus, 25-35 parts of sappanwood The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 35 to 45 parts of radix notoginseng, 25 to 35 parts of bodhi, 25 to 35 parts of radix aristolochiae fordianae, 17 to 23 parts of crane knee, 30 to 40 parts of caulis sargentodoxae, 20 to 30 parts of cyathea spinulosa wall, 35 to 45 parts of tinospora sinensis merr, 25 to 35 parts of ardisia punctata, 35 to 45 parts of knottedflower knotweed root, 20 to 30 parts of flos carthami, 35 to 45 parts of cynanchum otophyllum, 25 to 35 parts of schizophragma serratum, 25 to 35 parts of radix cynanchi paniculati and 35 to 45 parts of champion bauhinia root. The traditional Chinese medicine is reasonable and unique in compatibility, remarkable in curative effect and comprehensive in efficacy and gives consideration to exterior and interior.

The invention discloses a generation method of a hybrid sweetgum sulphonin-dependent nutritive organ-derived somatic embryo, which comprises the following steps: taking a mature nutritive organ as an explant, and carrying out callus induction, callus proliferation, embryogenic callus maturation, somatic embryo induction and somatic embryo development on a culture medium containing sulphonin, and performing somatic embryo germination on a culture medium which does not contain sulfonatin. According to the method disclosed by the invention, the induction of hybrid sweetgum leaf origin cotyledon embryos is realized in high-embryogenic genotypes and low-embryogenic genotypes by utilizing novel plant small peptide sulphogenin, and the sulphogenin is proved to be capable of remarkably improving the leaf callus induction rate, the cotyledon embryo formation rate and the germination rate, so that a stable and efficient system is provided for subsequent theoretical exploration, and the method has the advantages of being simple in process, low in cost and good in application prospect. And a solid foundation is laid for the development of hybrid sweetgum clonal forestry.

The utility model relates to the technical field of acer truncatum planting, and discloses a fertilizing device for acer truncatum planting, which comprises a material containing barrel, the lower end of the material containing barrel is fixedly connected with a supporting column, the supporting column is fixedly connected with a first fixing plate, the output end of a second servo motor is fixedly connected with a first electric telescopic rod, and the output end of the second servo motor is fixedly connected with a second electric telescopic rod. A drill bit is fixedly connected to one end of the first electric telescopic rod, a second electric telescopic rod is fixedly connected to the second fixing plate, a first discharging pipe is fixedly connected to one end of the second electric telescopic rod, a feeding groove is formed in the first discharging pipe, a hose is connected to the lower end of the containing barrel in a penetrating mode, and the hose is attached to the feeding groove. The rack slides on the supporting column, at the moment, the second electric telescopic rod is started to enable fertilizer to flow into a hole drilled by the drill bit from the first discharging pipe, the second electric telescopic rod is started to block one end of the hose through the surface of the first discharging pipe, in this way, the fertilization efficiency can be effectively improved, and fertilization can be more uniform.

This invention discloses an antitumor natural drug composition based on Norway maple and its preparation method, relating to the field of biomedical technology. The compound is selected from at least one of the following structures: 3-O-[β-D-glucopyranosyl-(1→4)-[β-D-galactopyranosyl-(1→2)]]-β-D-glucopyranoside-21-O-acetyl-22-O-angeloyl yrutile alcohol, with the molecular formula C2. 55 H 86 O 23 This invention isolates a class of triterpenoid saponins with a rutinol skeleton from the bark of Norwegian maple, enriching the chemical composition library of maple species. The compounds contain unique oligosaccharide chains and diacyl substitution patterns at C-21 and C-22. One compound has a rare branched acyl group (3-hydroxy-4-methylhexanoyl) at C-21, while the other compound contains an arabinofuranose unit in its C-3 trisaccharide chain. These structural features are rare in natural products and demonstrate excellent structural novelty.

1. The name of this design product: Plant Umbrella (Natural Silk Maple Leaf). 2. Application of this design product: for oil-paper umbrellas. 3. The key design point of this design product lies in the combination of shape and pattern. 4. The picture or photo that best illustrates the design points: three-dimensional picture.

1. Name of the designed product: bottle (white gold maple leaf). 2. Use of the designed product: for containing liquid. 3. Design points of the designed product: in the shape, pattern and combination thereof. 4. Picture or photo best indicating the design points: design 1 perspective view 1. 5. Other circumstances or explanations: specify design 1 as the basic design.

The application discloses a maple good variety breeding method based on leaf color evaluation of colorful maple, which is to collect maple seeds of different families to breed seedlings and use the seedlings to build test forests, after the test forests are built, the test forests are determined in December every year when the maple leaves change color in the peak period; the determined indexes include leaf color indexes and growth indexes; the leaf color indexes include leaf color system, single plant color changing amount and leaf CIE-Lab color space parameters; the growth indexes include preservation rate and leaf health degree; the maple family varieties reaching the various indexes are selected as the final selected excellent color changing family, and then the maple forest is cultivated and built according to the seed propagation, seedling cultivation, afforestation land preparation, afforestation, tending, topdressing and forest land management and the like in the built test forests. The application can not only breed the excellent color changing family of maple, but also has the advantages of being convenient, effective and suitable for popularization and application.

Materials and methods are provided for preventing and dispersing biofilms. Methods and compositions are described for preventing and treating dental caries. Materials and methods are provided for producing antibiofilm agents from natural products, including maple (Acer sp.). Compositions are provided for inhibiting Sortase A activity in Bacillota.

The application belongs to the technical field of species identification, and particularly relates to an InDel molecular marker for identifying a lophatherum gracile population and application. The application provides three InDel molecular markers MLP, LZ and WS for identifying the lophatherum gracile population for the first time. The molecular marker MLP is used for identifying the Malipu population of the lophatherum gracile, the molecular marker LZ is used for identifying the Laozhai population of the lophatherum gracile, and the molecular marker WS is used for identifying the Wenshan population of the lophatherum gracile. Primers for amplifying the molecular markers MLP, LZ and WS are designed, and a lophatherum gracile population identification method is developed. The method can not only accurately and effectively distinguish the plant material from the lophatherum gracile from the material of its close relative species, but also can simply and efficiently identify the geographical population type of the lophatherum gracile sample, and distinguish the Malipu population, the Laozhai population and the Wenshan population of the lophatherum gracile.

1. Name of the designed product: bottle (maple tree). 2. Use of the designed product: for containing liquid. 3. Design points of the designed product: in the shape, pattern and their combination. 4. Picture or photo best indicating the design points: perspective view 1.

The invention relates to the technical field of natural product extraction, in particular to an extraction method and application of fresh acer truncatum leaf essential oil, and the method comprises the following steps: (1) crushing, (2) mixing and (3) extracting, the method adopts a salt-assisted steam distillation method to extract the fresh acer truncatum leaf essential oil as a Yao medicine. Auxiliary extraction has the advantages of less pollution, high extraction rate, low cost, high efficiency, energy conservation and the like. In addition, the fresh acer truncatum leaf essential oil can be applied to preparation of skin care products, and the skin care products prepared by taking the fresh acer truncatum leaf essential oil as the raw material have the effects of inhibiting bacteria, resisting oxidation and whitening.

The invention relates to the technical field of biological medicine, and particularly discloses an acer truncatum seed oil soft capsule for relieving fatigue caused by staying up late, which comprises a capsule core and a capsule skin, the capsule core is prepared from the following raw materials in parts by weight: 10-20 parts of acer truncatum seed oil, 5-12 parts of a moringa oleifera leaf extract, 3-8 parts of a tribulus terrestris extract, 3-5 parts of a ginseng extract and 3-5 parts of a rhodiola rosea extract; the capsule skin is xanthan gum and / or gelatin; the weight ratio of the capsule core to the capsule skin is 1: (0.3-0.5); the invention also provides a preparation method of the acer truncatum seed oil soft capsule. The acer truncatum seed oil soft capsule provided by the invention has good effects of refreshing mind and relieving staying-up fatigue, and can meet the urgent demand of modern people on safe and efficient staying-up fatigue relieving products.

The invention discloses a making method of low-GI black sweetgum leaf zongzi, which comprises the following steps: selecting freshly picked sweetgum leaves, removing attached branches, thin stems and damaged leaves, washing with flowing clear water for 3-5 times, and drying in a constant-temperature drying box at 35 DEG C until the water content is 12-15%; deionized water with the conductivity smaller than or equal to 10 [mu] S / cm after pretreatment is injected into a crusher, the dried liquidambar formosana hance leaves are added according to the solid-to-liquid ratio of 1: 5, crushing is conducted for 25 seconds at the rotating speed of 12000 r / min, the same amount of deionized water is supplemented after crushing is completed, meanwhile, vitamin C accounting for 0.3% of the mass of the liquidambar formosana hance leaves is added to serve as a color fixative, stirring is conducted for 15 minutes at the temperature of 30 DEG C, and a liquidambar formosana hance leaf aqueous solution is prepared; preparing black fermentation liquor; glutinous rice dyeing, color fixation, anti-oxidation strengthening and low-GI composite conditioning treatment; and making and cooking the zongzi. The glutinous rice wine has the advantages of slowing down digestion and absorption of glutinous rice, avoiding rapid increase of blood sugar, being beneficial to healthy diet, improving color and luster, optimizing taste, preventing leaf sticking, resisting bacteria and prolonging the storage life after refrigeration.

A new and distinct cultivar of Japanese Maple tree named ‘Autken1’, characterized by its upright to outwardly spreading plant form; moderately vigorous growth habit; freely branching habit with numerous lateral branches providing a full and densely foliated appearance; leaves with narrow and pointed lobes and finely-serrated margins; and dark reddish brown-colored leaves that become bright cherry red in color during the autumn.

The invention provides a method for collecting liquidambar formosana resin through film covering and a storage method of the liquidambar formosana resin, and relates to the technical field of liquidambar formosana resin tapping, specifically, the method for collecting the liquidambar formosana resin through film covering comprises the following steps: (1) pretreatment, (2) bark treatment, (3) film covering and (4) subsequent resin tapping. In addition, after collection, the obtained liquidambar formosana hance resin is stored with sterilized water. The collection method is matched with the storage method, so that the collected resina liquidamberis is high in quality, the shelf life is prolonged, the resina collecting cost is reduced, and the economic benefit is increased.

The invention discloses a moso bamboo PeBBX19 gene as well as an encoding protein and application thereof, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the phyllostachys pubescens PeBBX19 gene disclosed by the invention is as shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein of the phyllostachys pubescens PeBBX19 gene is as shown in SEQ ID NO.2. The method comprises the following steps: constructing an overexpression vector of a moso bamboo PeBBX19 gene; the constructed overexpression vector of the moso bamboo PeBBX19 gene is transformed into arabidopsis thaliana; and cultivating and screening to obtain the transgenic arabidopsis thaliana strain with delayed flowering time. The invention discloses the function of the PeBBX19 gene for the first time, the flowering time of a transgenic plant is delayed after the gene is transformed into an arabidopsis thaliana plant, an obvious late flowering phenotype is shown, and the number of rosette leaves is increased; and the FT expression quantity of the downstream regulation gene is obviously reduced.

The invention discloses a traditional Chinese medicine composition for treating wound ulcer and a preparation method thereof, and belongs to the technical field of traditional Chinese medicines. The prescription is composed of 5-15 parts of slender gouania root, 5-10 parts of maggot, 0.01-0.5 part of venenum bufonis, 5-10 parts of American cockroach, 5-15 parts of abelmoschus manihot, 3-9 parts of rheum officinale, 1-5 parts of safflower and 5-15 parts of fructus chebulae, the dosage form is external ointment, powder, oil, liquid preparation and the like, the traditional Chinese medicine composition is remarkable in curative effect, the cure rate can reach 85% or above after 2 months of treatment, the average healing time is shortened by 40 days or above, safety is high, and the traditional Chinese medicine composition is suitable for clinical application. The traditional Chinese medicine composition is suitable for chronic intractable wound ulcer such as diabetic foot ulcer, and the problem of poor treatment effect in the prior art is solved.