38 results about "Maple" patented technology

The invention provides a trichoderma maple fungicide, a microbial granular fertilizer as well as a preparation method and application of the trichoderma maple fungicide and the microbial granular fertilizer, and relates to the field of microorganisms. The acer rubrum fungicide contains acer rubrum RA with the preservation number of CGMCC No.35889. The acer rubrum fungicide has the capability of decomposing inorganic phosphorus, is wide in phosphorus dissolving range, can decompose tricalcium phosphate, ferric phosphate and aluminum phosphate, and particularly still has the very strong capability of decomposing the inorganic phosphorus under the low-temperature condition; the strain has the capability of producing siderophore and IAA at low temperature; the strain has an inhibition effect on various pathogenic bacteria causing field crop diseases. The microbial granular fertilizer provided by the invention contains various biostimulant substances, can promote crop growth, improve plant stress resistance and improve plant resistance to plant diseases and insect pests, and field tests prove that the microbial granular fertilizer can significantly promote crop growth and improve crop yield.

The invention belongs to the technical field of molecular biology, and particularly discloses a primer capable of identifying five acer species at the same time and application of the primer, the primer comprises AcerTS-F: CGGAACTAGTCGGATGGAGT; the invention relates to a method for preparing an Ac < S-R >: GAAGCAGTTCGAGACAACCG; respectively extracting total DNA (deoxyribonucleic acid) of acer palmatum, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum plants; carrying out PCR (Polymerase Chain Reaction) amplification on the total DNA (Deoxyribose Nucleic Acid) of each species by using the AcerTS-F and the AcerTS-R; after PCR products are sequenced, sequence comparison is carried out, five acer species including acer northeast, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum can be identified at the same time, and precious genetic resources are provided for genetic diversity, phylogenetic evolution and taxonomy research of the acer species.

This invention discloses an anti-wrinkle and soothing composition and its preparation method, belonging to the field of cosmetic technology. The composition includes the following steps: mixing and stirring a moisturizer, antioxidant, emollient, deionized water, ginseng root extract, snow lotus (SAUSSUREA INVOLUCRATA) extract, dark green agave (AGAVE ATROVIRENS) extract, umbrella maple leaf extract, and lotus coronulatus flower extract until homogeneous, thus obtaining the anti-wrinkle and soothing composition. Utilizing the synergistic effects between the components, it possesses both anti-wrinkle and soothing effects, synergistically improving skin aging problems.

The invention relates to the technical field of acer truncatum seed oil processing, in particular to an acer truncatum seed oil processing and squeezing assembly which mainly comprises a material barrel, a transmission rod is rotationally arranged in the material barrel, and a spiral oil squeezing plate is installed on the outer surface of the transmission rod; the box body is arranged below the charging barrel, at least one group of fixed frames are arranged in the box body, and filter plates are arranged at the bottom ends in the fixed frames; the scraping assembly is slidably arranged at the position, corresponding to the upper portion of the filter plate, in the box body and used for scraping impurities attached to the upper end face of the filter plate, and the scraping assembly comprises an elastically-arranged scraping plate; the acer truncatum seed oil is filtered through a filter plate, in the filtering process, a rotating transmission rod downwards presses a connecting plate through an abutting rod, the connecting plate extrudes a second air bag through an extrusion plate, air in the second air bag is exhausted into a first air bag through an exhaust pipeline, and the first air bag expands to push a guide block to move; and then an elastically-arranged scraping plate is driven to scrape the impurities, and the impurities are scraped into the storage box.

The invention discloses an automatic dehulling and seed taking system for acer palmatum seeds, the system comprises an arranging device and a cutting device, the arranging device is used for sequencing the acer palmatum seeds, the cutting device is used for cutting the sequenced acer palmatum seeds to obtain seed kernels, the cutting device comprises a material taking clamp, a cutter and a lower die, the material taking clamp is used for clamping and moving seeds, the cutter is used for cutting the seeds, and the lower die is used for positioning the seeds in the cutting process. The automatic acer palmatum seed shelling and taking system disclosed by the invention has the advantages that the production efficiency is greatly improved, the damage to the seeds is reduced, the structure is simple, the service life is long, and the like.

The invention discloses all-traditional Chinese medicine traumatic injury medicinal liquor and a preparation method thereof, and belongs to the field of traditional Chinese medicine. The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 25-35 parts of rubus suavissimus, 35-45 parts of ventilago leiocarpa benth, 25-35 parts of fructus schisandrae chinensis, 12-18 parts of asarum sieboldii, 35-45 parts of semiliquidambar cathayensis, 35-45 parts of entada phaseoloides, 17-23 parts of kadsura pepper stem, 25-35 parts of lindera glauca, 35-45 parts of lysimachia christinae hance, 25-35 parts of angelica sinensis, 25-35 parts of berchemia lineate, 35-45 parts of oxalis, 35-45 parts of radix achyranthis bidentatae, 17-23 parts of artabotrys hexapetalus, 25-35 parts of sappanwood The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 35 to 45 parts of radix notoginseng, 25 to 35 parts of bodhi, 25 to 35 parts of radix aristolochiae fordianae, 17 to 23 parts of crane knee, 30 to 40 parts of caulis sargentodoxae, 20 to 30 parts of cyathea spinulosa wall, 35 to 45 parts of tinospora sinensis merr, 25 to 35 parts of ardisia punctata, 35 to 45 parts of knottedflower knotweed root, 20 to 30 parts of flos carthami, 35 to 45 parts of cynanchum otophyllum, 25 to 35 parts of schizophragma serratum, 25 to 35 parts of radix cynanchi paniculati and 35 to 45 parts of champion bauhinia root. The traditional Chinese medicine is reasonable and unique in compatibility, remarkable in curative effect and comprehensive in efficacy and gives consideration to exterior and interior.

The invention discloses a generation method of a hybrid sweetgum sulphonin-dependent nutritive organ-derived somatic embryo, which comprises the following steps: taking a mature nutritive organ as an explant, and carrying out callus induction, callus proliferation, embryogenic callus maturation, somatic embryo induction and somatic embryo development on a culture medium containing sulphonin, and performing somatic embryo germination on a culture medium which does not contain sulfonatin. According to the method disclosed by the invention, the induction of hybrid sweetgum leaf origin cotyledon embryos is realized in high-embryogenic genotypes and low-embryogenic genotypes by utilizing novel plant small peptide sulphogenin, and the sulphogenin is proved to be capable of remarkably improving the leaf callus induction rate, the cotyledon embryo formation rate and the germination rate, so that a stable and efficient system is provided for subsequent theoretical exploration, and the method has the advantages of being simple in process, low in cost and good in application prospect. And a solid foundation is laid for the development of hybrid sweetgum clonal forestry.

This invention discloses an antitumor natural drug composition based on Norway maple and its preparation method, relating to the field of biomedical technology. The compound is selected from at least one of the following structures: 3-O-[β-D-glucopyranosyl-(1→4)-[β-D-galactopyranosyl-(1→2)]]-β-D-glucopyranoside-21-O-acetyl-22-O-angeloyl yrutile alcohol, with the molecular formula C2. 55 H 86 O 23 This invention isolates a class of triterpenoid saponins with a rutinol skeleton from the bark of Norwegian maple, enriching the chemical composition library of maple species. The compounds contain unique oligosaccharide chains and diacyl substitution patterns at C-21 and C-22. One compound has a rare branched acyl group (3-hydroxy-4-methylhexanoyl) at C-21, while the other compound contains an arabinofuranose unit in its C-3 trisaccharide chain. These structural features are rare in natural products and demonstrate excellent structural novelty.

1. The name of this design product: Plant Umbrella (Natural Silk Maple Leaf). 2. Application of this design product: for oil-paper umbrellas. 3. The key design point of this design product lies in the combination of shape and pattern. 4. The picture or photo that best illustrates the design points: three-dimensional picture.

1. Name of the designed product: bottle (white gold maple leaf). 2. Use of the designed product: for containing liquid. 3. Design points of the designed product: in the shape, pattern and combination thereof. 4. Picture or photo best indicating the design points: design 1 perspective view 1. 5. Other circumstances or explanations: specify design 1 as the basic design.

The application discloses a maple good variety breeding method based on leaf color evaluation of colorful maple, which is to collect maple seeds of different families to breed seedlings and use the seedlings to build test forests, after the test forests are built, the test forests are determined in December every year when the maple leaves change color in the peak period; the determined indexes include leaf color indexes and growth indexes; the leaf color indexes include leaf color system, single plant color changing amount and leaf CIE-Lab color space parameters; the growth indexes include preservation rate and leaf health degree; the maple family varieties reaching the various indexes are selected as the final selected excellent color changing family, and then the maple forest is cultivated and built according to the seed propagation, seedling cultivation, afforestation land preparation, afforestation, tending, topdressing and forest land management and the like in the built test forests. The application can not only breed the excellent color changing family of maple, but also has the advantages of being convenient, effective and suitable for popularization and application.

The application belongs to the technical field of species identification, and particularly relates to an InDel molecular marker for identifying a lophatherum gracile population and application. The application provides three InDel molecular markers MLP, LZ and WS for identifying the lophatherum gracile population for the first time. The molecular marker MLP is used for identifying the Malipu population of the lophatherum gracile, the molecular marker LZ is used for identifying the Laozhai population of the lophatherum gracile, and the molecular marker WS is used for identifying the Wenshan population of the lophatherum gracile. Primers for amplifying the molecular markers MLP, LZ and WS are designed, and a lophatherum gracile population identification method is developed. The method can not only accurately and effectively distinguish the plant material from the lophatherum gracile from the material of its close relative species, but also can simply and efficiently identify the geographical population type of the lophatherum gracile sample, and distinguish the Malipu population, the Laozhai population and the Wenshan population of the lophatherum gracile.

1. Name of the designed product: bottle (maple tree). 2. Use of the designed product: for containing liquid. 3. Design points of the designed product: in the shape, pattern and their combination. 4. Picture or photo best indicating the design points: perspective view 1.

The invention relates to the technical field of biological medicine, and particularly discloses an acer truncatum seed oil soft capsule for relieving fatigue caused by staying up late, which comprises a capsule core and a capsule skin, the capsule core is prepared from the following raw materials in parts by weight: 10-20 parts of acer truncatum seed oil, 5-12 parts of a moringa oleifera leaf extract, 3-8 parts of a tribulus terrestris extract, 3-5 parts of a ginseng extract and 3-5 parts of a rhodiola rosea extract; the capsule skin is xanthan gum and / or gelatin; the weight ratio of the capsule core to the capsule skin is 1: (0.3-0.5); the invention also provides a preparation method of the acer truncatum seed oil soft capsule. The acer truncatum seed oil soft capsule provided by the invention has good effects of refreshing mind and relieving staying-up fatigue, and can meet the urgent demand of modern people on safe and efficient staying-up fatigue relieving products.

The invention discloses a making method of low-GI black sweetgum leaf zongzi, which comprises the following steps: selecting freshly picked sweetgum leaves, removing attached branches, thin stems and damaged leaves, washing with flowing clear water for 3-5 times, and drying in a constant-temperature drying box at 35 DEG C until the water content is 12-15%; deionized water with the conductivity smaller than or equal to 10 [mu] S / cm after pretreatment is injected into a crusher, the dried liquidambar formosana hance leaves are added according to the solid-to-liquid ratio of 1: 5, crushing is conducted for 25 seconds at the rotating speed of 12000 r / min, the same amount of deionized water is supplemented after crushing is completed, meanwhile, vitamin C accounting for 0.3% of the mass of the liquidambar formosana hance leaves is added to serve as a color fixative, stirring is conducted for 15 minutes at the temperature of 30 DEG C, and a liquidambar formosana hance leaf aqueous solution is prepared; preparing black fermentation liquor; glutinous rice dyeing, color fixation, anti-oxidation strengthening and low-GI composite conditioning treatment; and making and cooking the zongzi. The glutinous rice wine has the advantages of slowing down digestion and absorption of glutinous rice, avoiding rapid increase of blood sugar, being beneficial to healthy diet, improving color and luster, optimizing taste, preventing leaf sticking, resisting bacteria and prolonging the storage life after refrigeration.

A new and distinct cultivar of Japanese Maple tree named ‘Autken1’, characterized by its upright to outwardly spreading plant form; moderately vigorous growth habit; freely branching habit with numerous lateral branches providing a full and densely foliated appearance; leaves with narrow and pointed lobes and finely-serrated margins; and dark reddish brown-colored leaves that become bright cherry red in color during the autumn.

The invention discloses a traditional Chinese medicine composition for treating wound ulcer and a preparation method thereof, and belongs to the technical field of traditional Chinese medicines. The prescription is composed of 5-15 parts of slender gouania root, 5-10 parts of maggot, 0.01-0.5 part of venenum bufonis, 5-10 parts of American cockroach, 5-15 parts of abelmoschus manihot, 3-9 parts of rheum officinale, 1-5 parts of safflower and 5-15 parts of fructus chebulae, the dosage form is external ointment, powder, oil, liquid preparation and the like, the traditional Chinese medicine composition is remarkable in curative effect, the cure rate can reach 85% or above after 2 months of treatment, the average healing time is shortened by 40 days or above, safety is high, and the traditional Chinese medicine composition is suitable for clinical application. The traditional Chinese medicine composition is suitable for chronic intractable wound ulcer such as diabetic foot ulcer, and the problem of poor treatment effect in the prior art is solved.

The present invention relates to the technical field of inorganic photocatalysis, and specifically discloses a three-dimensional maple leaf micro-nano flower Cd<subgt;0.8< / subgt;Zn<subgt;0.2< / subgt;S photocatalyst and a preparation method thereof. The preparation method includes the following steps: Step 1: Take Cd(NO<subgt;3< / subgt;)<subgt;2< / subgt>·4H<subgt;2O, Zn(NO<subgt;3< / subgt;)<subgt;2·6H<subgt;2O, and H<subgt;2NCSNH<subgt;2 and mix them to obtain a mixed solution; Step 2: Add an ethylenediamine aqueous solution to the mixed solution and stir to obtain a suspension; and the ethylenediamine aqueous solution is obtained by mixing ethylenediamine and water in a volume ratio of 2:(1-4); Step 3: Pour the suspension into the inner lining of a reaction kettle, stir, and carry out hydrothermal reaction at 160-200 °C for 6-24 h; Step 4: After cooling to room temperature, centrifuge and wash with absolute ethanol and distilled water respectively for multiple times, and then dry overnight in vacuum to obtain the Cd<subgt;0.8< / subgt;Zn<subgt;0.2S photocatalyst. The three-dimensional maple leaf micro-nano flower Cd<subgt;0.8< / subgt;Zn<subgt;0.2S photocatalyst prepared by the preparation method in the present invention can effectively improve the photocatalytic effect for the problem that most semiconductor catalysts have a relatively wide energy band and are difficult to effectively absorb visible light.

A one- or multi-piece wooden stock of a handgun, which is attached to a barrel via a receiver containing a locking system and a trigger assembly, should be designed to achieve a lightweight, stable wooden stock with reduced wood expansion and an aesthetically pleasing appearance. This is achieved by manufacturing the wooden stock, or the buttstock and / or fore-end, from European wood with a density between 300 kg / m³ and 1100 kg / m³, the wood originating from one of the following tree families: Oak (Quercus), beech (Fagus), elm (Ulmus), birch (Betula), linden (Tilia), cherry (Prunus), olive tree (Olea europaea), maple (Acer), plane tree (Platanus) or mulberry (Morus) and the wooden stock is screwed to the system box.

The present invention discloses a maple leaf-shaped gold nanocrystal and its application in detecting α-amanitin, belonging to the field of molecular biology detection. In the present invention, L-glutathione is used to promote the asymmetric evolution of gold seeds to prepare a maple leaf-shaped gold nanocrystal (ML-Au), and the aptamer is optimized and truncated to obtain a 20-base short aptamer for α-amanitin, and a biosensor for detecting α-amanitin is prepared. The linear range of the biosensor B1 of the present invention for detecting α-amanitin is 1×10<supgt;−9< / supgt> to 1×10<supgt;−14< / supgt> M (0.9 to 9×10<supgt;5< / supgt> ng / mL), the detection limit is 2.9×10<supgt;−15< / supgt> M (2.61×10<supgt;−3< / supgt> ng / mL), and the detection time only needs 25 min, having the advantages of high sensitivity and rapid detection.

The invention provides black glutinous rice with unique maple fragrance and a preparation method of the black glutinous rice. The method comprises the following steps: separating branches and leaves of liquidambar formosana hance, crushing and oxidizing the branches, soaking and separating the leaves in the presence of cellulase, pectinase and glucosidase under the action of electric shock to obtain filtrate and filter residues, soaking glutinous rice in the filtrate under the action of electric shock, steaming the soaked glutinous rice, and cooling to obtain the glutinous rice wine. And paving the oxidized branches or the filter residues of the branches and the leaves below gauze, and continuing steaming. The black glutinous rice prepared by the method disclosed by the invention is stable in black effect and rich in maple flavor. Compared with a method recorded in a Chinese patent (CN111317092B), the method does not need to add extra reagents, such as a calcium preparation and an iron preparation for enhancing maple leaf pigment color development and enhancing calcium and iron elements, amylase, apple polyphenol, polylysine and the like, and the glutinous rice with stable black effect and unique maple fragrance can be obtained only by taking branches and leaves of the maple tree as raw materials. Compared with a method recorded in a Chinese patent (the application number is 201510357468.0), the method disclosed by the invention overcomes the defects that the black glutinous rice prepared in the patent is very easy to be gray or brown and cannot achieve a black effect.

The application discloses a tissue culture method using maple zygotic embryos as explants and relates to the technical field of plant tissue culture.The method comprises the following steps: S1, cutting the zygotic embryos of immature maple fruits and inoculating the zygotic embryos onto a callus induction culture medium to induce callus; S2, transferring the callus induced in S1 to a bud induction culture medium to induce adventitious buds; and S3, inoculating the adventitious buds formed in step S2 into a strong seedling rooting culture medium to induce rooting, directly forming regenerated seedlings and carrying out transplanting culture.Compared with the culture methods using other maple tissues as explants, the method is more convenient, has higher genotype universality and is more efficient in propagation.

The invention provides a culture medium for tissue culture of ornamental acer elegans and a tissue culture method, and belongs to the technical field of tissue culture, the culture medium provided by the invention comprises a basic culture medium, and the basic culture medium comprises the following components: 750-850mg / L of potassium nitrate; 160 to 180 mg / L of monopotassium phosphate; magnesium sulfate heptahydrate with a concentration of 170 to 200 mg / L; 40 to 50 mg / L of calcium chloride dihydrate; 5.5 to 7.0 mg / L of boric acid; 4.5 to 5.5 mg / L of zinc sulfate heptahydrate; inositol in an amount of 80 to 120 mg / L; 0.3 g / L to 1.0 g / L of activated carbon; and 25-35 g / L of sucrose. By adopting the culture medium and the tissue culture method provided by the invention, yellow green granular calluses can be formed in 20 days at the soonest, the bud differentiation number can be more than or equal to 4 / callus block in 25 days, the rooting rate can be more than 80% in 14 days, and no browning and vitrified seedlings appear, so that the problems of high browning rate, more vitrified seedlings, rooting difficulty and the like in the traditional tissue culture of the ornamental acer elegans are solved; efficient and low-distortion full-period culture is realized, and reliable technical support is provided for large-scale propagation of rare tree species.

A new and distinct variety of Japanese maple tree having a small to moderate-size with red-lace leaves that turn greyish red with maturity, that is hardy in USDA Zones 4 to 8, with an arching, cascading branching and a moderate growth rate with a mushroom-like habit, is disclosed.

The invention provides a phosphorus-solubilizing nitrogen-fixing recarburization functional bacterium and application thereof in fertile soil growth promotion, and belongs to the technical field of agricultural microorganisms. The rahnella maple ZC-7 is preserved in the China Center for Type Culture Collection, the preservation number is CCTCC NO: M 20252883, the preservation time is December 15, 2025, and the preservation address is Wuhan University. The strain has the effects of dissolving phosphorus, fixing nitrogen, producing IAA and the like. In addition, the strain is wide in carbon source utilization spectrum, has resistance to various chemical substances and can adapt to various soil environments. The strain can obviously promote the growth of corn plants and increase the corn yield, and field tests show that the use of chemical fertilizers can be reduced and the corn yield can be increased by 27% by applying a microbial agent containing the strain. The strain has comprehensive functions and strong adaptability, provides technical support for green agriculture development, and has important application value.

A connecting assembly for operatively and fluidly connecting at least first and second hose segments together. The connecting assembly includes at least one insert portion, and corresponding bulge(s), securing device(s) and fluid passage(s). The securing device is removably mounted onto and displaceable about a portion of a given length span of the insert portion, and configured for operation between a first release mode, where the securing device being is drawn away from the bulge and thus an extremity of the hosing segment is releasable, and a second connecting mode, where the securing device is removably and selectively displaced over an outward overlapping of the extremity of the hosing segment extending over the bulge, so as to securely maintain said extremity of the hosing segment in place, operatively against the bulge and thus, prevent the first extremity of the first hosing segment from being removed from the bulge.

1. Name of the product in this design: Craft (Maple Forest Sword). 2. Purpose of this design: a handicraft for display, appreciation, or collection. 3. The key design features of this product are the combination of shape and pattern. 4. The image or photograph that best illustrates the design's key points: 3D view 1.

The present invention discloses an eye cream containing an effective composition for improving eye skin problems and a preparation method thereof, and belongs to the technical field of cosmetics. The eye cream provided by the present invention contains a repair composition, and the repair composition includes the following raw materials: red maple extract, red ball ginger extract, Dendrobium candidum extract, North American pine bark extract, Fleischer's epilobium extract. The repair composition provided by the present invention has the effects of anti-aging, light wrinkles, and improving skin cell migration rate, and is mild and non-irritating as a whole; applying the repair composition of the present invention to the eye cream can effectively resist aging, light wrinkles, improve skin elasticity and increase the water content of the stratum corneum. In addition, the components of the composition provided by the present invention are of natural origin, the preparation method is simple, and it is suitable for actual production.