42 results about "Chinese ginseng root" patented technology

The invention relates to the technical field of food, in particular to a composition for relieving anxiety and improving sleep and a preparation method and application thereof, and the composition is composed of jujuboside, anthocyanin, gamma-aminobutyric acid and ginsenoside Rb1. The jujuboside is derived from spina date seeds, the anthocyanin is derived from at least one of lycium ruthenicum, blueberry purple epidermis, aronia melanocarpa and mulberries, and the ginsenoside Rb1 is derived from at least one of ginseng roots, ginseng stems and leaves, ginseng flowers, panax notoginseng roots, panax notoginseng stems and leaves, panax notoginseng flowers, panax notoginseng fibrous roots and American ginseng. According to the invention, a plurality of components are synergistic, the efficacy is comprehensive and the pertinence is strong, the effective components are not simply mixed, but form a highly synergistic action system, and the efficacy covers multiple dimensions of improving sleep, relieving anxiety and improving the overall state.

The invention discloses a method for preparing high-purity ginsenoside Rh2, panoxadiol type total saponins extracted and separated from ginseng roots or ginseng stems and leaves are taken as a substrate, two-step combined enzyme hydrolysis is utilized to convert a diol type ginsenoside mixture into rare ginsenoside Rh2, and the ginsenoside Rh2 with the purity of more than or equal to 98.5% is obtained by recrystallizing the product. The preparation method has industrial prospects, and the product can be used as a raw material of medicines and other products.

The invention relates to a method for relieving continuous cropping obstacles of ginseng and application of the method, and belongs to the technical field of agricultural planting. The method comprises the following specific steps: planting wrinkled gianthyssop herb on a field after ginseng planting, crushing the wrinkled gianthyssop herb, returning the crushed wrinkled gianthyssop herb to the field, and improving soil for subsequent ginseng planting. The method can effectively relieve continuous cropping obstacles of ginseng, increase the content of soil organic matter, nitrogen, phosphorus and potassium, adjust the pH of soil, improve the activity of soil catalase, reduce the activity of sucrase and urease, optimize the microbial community structure of soil, reduce the abundance of pathogenic bacteria and reduce the incidence rate of root rot and rust rot of ginseng; the yield and quality of ginseng are remarkably improved, the ginsenoside content is increased, meanwhile, use of chemical fertilizers and pesticides is reduced, a green and safe planting mode is achieved, and remarkable economic benefits and ecological benefits are achieved.

The invention relates to the technical field of medicine extraction, in particular to a method for extracting ginseng essential oil through combination of a deep eutectic solvent-supercritical technology and column chromatography. The method comprises the following steps: (1) crushing ginseng root hair, adding the crushed ginseng root hair into a supercritical extraction kettle, and carrying out supercritical extraction under the combined action of liquid CO2 and an entrainer to obtain an extract; the entrainer comprises absolute ethyl alcohol and a eutectic solvent; and (2) concentrating the extract until no ethanol exists, diluting with water, adsorbing with macroporous resin, carrying out column chromatography, washing with water, eluting with 2%-5% ethanol, eluting with 10%-20% ethanol, collecting 10%-20% ethanol eluent, and drying to obtain the product. The method has the advantages of high yield, high ginseng alkynol content, short extraction period and no environmental pollution.

This invention discloses an anti-wrinkle and soothing composition and its preparation method, belonging to the field of cosmetic technology. The composition includes the following steps: mixing and stirring a moisturizer, antioxidant, emollient, deionized water, ginseng root extract, snow lotus (SAUSSUREA INVOLUCRATA) extract, dark green agave (AGAVE ATROVIRENS) extract, umbrella maple leaf extract, and lotus coronulatus flower extract until homogeneous, thus obtaining the anti-wrinkle and soothing composition. Utilizing the synergistic effects between the components, it possesses both anti-wrinkle and soothing effects, synergistically improving skin aging problems.

The invention provides a conversion method of rare ginsenoside Rg5. According to the method, through a vacuum permeation technology, gas in cell gaps of ginseng roots is removed in a vacuum environment, a permeation barrier of cell walls is weakened, a micro-channel is formed, and then a mixed solution of methanol and n-butyl alcohol is injected for primary extraction; after the normal pressure is recovered, the mixed solution can be driven by differential pressure to quickly fill a micro-channel and be better dissolved with the ginseng roots, a more efficient extraction environment is created, extraction is carried out under the low-temperature condition of 30-50 DEG C, thermal degradation of PPD can be effectively avoided, meanwhile, dissolution of impurities such as polysaccharide and protein is reduced, and the adverse effect of the impurities on subsequent conversion is reduced; finally, cellulose nanocrystals and a hydrochloric acid solution are added, on the basis that extraction is further promoted, protopanoxadiol saponin can be efficiently and directionally converted into rare ginsenoside Rg5, meanwhile, generation of an isomeride Rk1 of the rare ginsenoside Rg5 is reduced, and then the yield and purity of the Rg5 are remarkably improved.

The invention provides a composition for promoting blackening of forehead white hair as well as a preparation method and application of the composition, and belongs to the technical field of cosmetics. The composition is prepared from the following components in parts by weight: 1 to 6.5 parts of radix ginseng, 1 to 44.5 parts of radix astragali membranaci extract, 0.1 to 4 parts of rhizoma atractylodis macrocephalae rhizome extract, 0.1 to 2.2 parts of rhizoma atractylodis rhizome extract, 0.01 to 5.334 parts of cortex magnoliae officinalis extract and 0.01 to 2.565 parts of herba leonuri extract. The ginseng root, the astragalus membranaceus root extract, the rhizoma atractylodis macrocephalae rhizome extract, the rhizoma atractylodis rhizome extract, the cortex magnoliae officinalis bark extract and the herba leonuri extract are added into the ethanol solution, so that the effects of active ingredients of the plant extracts can be effectively exerted, the hair and the nutritional ingredients required by hair follicles are provided, and the prehead white hair is synergistically promoted to be black. The preparation method is simple, easy to operate and suitable for industrial production.

The invention belongs to the technical field of plant beverage processing, and particularly relates to a gingko, dendrobium officinale and ginseng plant beverage crushing, mixing and preparing device which comprises a mixing and preparing machine, a universal pulverizer, an ultrafine pulverizer, a freezing pulverizer and a high-pressure homogenizer, and the mixing and preparing machine comprises a material cavity, a feeding opening, a discharging opening and a stirring mechanism; the preparation method of the mixing preparation machine comprises the following preparation steps: S1, raw material pretreatment: selecting ginkgo leaves, fresh dendrobium officinale strips and ginseng rhizomes which are free of mildew and diseases and insect pests, cleaning the ginkgo leaves, drying the ginkgo leaves with hot air, removing fibrous roots from the fresh dendrobium officinale strips, cutting the fresh dendrobium officinale strips into long sections, peeling the ginseng rhizomes, and cutting the peeled ginseng rhizomes into long slices; s2, graded crushing is conducted, specifically, the pretreated ginkgo leaves are put into a universal pulverizer to be pulverized and then transferred into an ultrafine pulverizer to be further pulverized into fine particles, and the device solves the problems that when the ginkgo, dendrobium officinale and ginseng plant beverage is prepared through crushing and mixing at present, the mixing effect is poor, and the stability and taste of the beverage are directly affected.

The invention provides a synthetic flora containing a complex microbial inoculant as well as a preparation method and application thereof, and relates to the technical field of microorganisms. The synthetic flora is composed of bacillus subtilis YX1 and pseudomonas marginata. Wherein the bacillus subtilis YX1 is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC No.31921; the pseudomonas marginata is preserved in the same mechanism, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) 1.2844. After the synthetic flora is applied to the rhizosphere of ginseng, the synthetic flora has good environmental adaptability and rhizosphere survival ability. Through the combination of the specific functional strains, long-acting colonization of functional microorganisms in an aluminum stress environment is realized, and an effective scheme is provided for solving the problem of unstable colonization of microbial preparations in the ginseng planting process.

The invention belongs to the technical field of separation methods of new natural compounds, and particularly relates to a separation method of new ginsenoside in ginseng. According to the separation method, ginseng roots serve as raw materials, sample segmentation and targeted enrichment of target compounds are carried out through ultrasonic extraction, normal-pressure and medium-pressure preparation and the like, then enrichment is further carried out through high-pressure semi-preparation, specific parameters are adopted in each step, and therefore the new ginsenoside can be separated from the ginseng roots. The discovery of the new ginsenoside is helpful for deeply exploring the action mechanism of the ginseng, and also possibly provides new active substances for disease treatment, so that the pharmaceutical application of the ginseng is further developed, and the economic value of the ginseng is improved.

The present invention discloses an anti-wrinkle skin care solution and its freeze-dried product and preparation method, comprising the following steps: S1, pretreatment of ginseng roots; S2, preparation of ginseng tissue; S3, induction culture: in an induction culture medium, the ginseng tissue obtained in step S2 is induced and cultured to prepare an initial ginseng cambium meristem cell line; S4, suspension culture: the initial ginseng cambium meristem cell line prepared in step S3 is suspended and cultured on a suspension culture medium, filtered through a 40 μm cell sieve, and the filtrate is collected to obtain the anti-wrinkle skin care solution. The anti-wrinkle skin care solution is freeze-dried to obtain an anti-wrinkle skin care freeze-dried product; the present invention uses cell culture fluid cultured with ginseng cells for freeze-drying, which can be applied to skin anti-wrinkle and anti-aging, and has a promoting effect on human cell activity and collagen expression. The method has mild and simple process conditions, no special requirements for equipment, and improves resource utilization, which is conducive to large-scale industrial production.

The invention discloses an anti-aging, face-beautifying and skin-care composition and a preparation method thereof, and relates to the technical field of cosmetics, the anti-aging, face-beautifying and skin-care composition comprises 1-10 parts of centella asiatica extract, 0.5-5 parts of sodium hyaluronate, 0.5-5 parts of grape seed extract, 0.1-2 parts of vitamin C, 0.5-3 parts of ceramide, 1-8 parts of ginseng root extract and 1-6 parts of green tea extract. According to the anti-aging, face-beautifying and skin-care composition and the preparation method thereof, centella asiatica and ceramide jointly build a tough barrier and deeply nourish the skin, grape seeds and vitamin C strongly resist oxidation and resist darkness, sodium hyaluronate cooperates with ginseng roots and the green tea extract to moisturize and refresh the skin, all the components closely cooperate, all-around anti-aging is achieved, the effect is far better than that of simple addition of a single component, and the composition is suitable for all-around skin care. In the aspect of a preparation process, parameters are optimized to improve the purity and the yield of active ingredients, the activity and the structure integrity of the ingredients are maintained by technologies such as supercritical COextraction and the like, and the product is durable and stable in high and low temperature environments and maintains the appearance, the texture and the activity due to a strict process and an ingenious formula.

The invention provides a disinfection method of a ginseng explant, which comprises the following steps: soaking and disinfecting the ginseng explant by using a chemical disinfectant, soaking the soaked and disinfected explant into a first ethanol solution, taking out, igniting residual ethanol on the surface of the explant, burning, and cooling. According to the method disclosed by the invention, conventional chemical disinfection and high-concentration ethanol infiltration-flame burning are creatively combined, and the step-by-step and synergistic sterilization strategy is particularly suitable for explants with complicated structures, such as ginseng roots. Compared with a traditional disinfection method needing long-time soaking and multiple times of rinsing, the method has the advantages that the total disinfection time is greatly shortened and the explant preparation efficiency is remarkably improved by introducing an instantaneous firing step, and the explant preparation efficiency is greatly improved by reducing the total contact time of a chemical disinfectant, inactivating surface polyphenol oxidase by utilizing instantaneous high temperature and combining rapid cooling. The browning reaction is effectively inhibited, and the activity of the explant is ensured.

The invention discloses an anti-hair-loss composition containing a cacumen biotae extract and a preparation method of the anti-hair-loss composition, and particularly belongs to the technical field of scalp care and raw material compounding. The anti-hair loss composition comprises the following components: 8-12 parts of a red ginseng extract, 8-12 parts of a Chinese arborvitae twig and leaf extract, 3-4 parts of a flat ground mushroom extract, 2-3 parts of a dendrobium officinale stem extract and 1-2 parts of lactobacillus / ginseng root fermentation product filtrate. The anti-alopecia composition provided by the invention has a remarkable effect of inhibiting the activity of 5alpha-reductase, can remarkably improve the alopecia phenomenon of mice, inhibits the generation of testosterone and dihydrotestosterone, and reduces the risk of androgen-derived alopecia.

The present invention belongs to the field of hair care technology and discloses an anti-hair loss composition, preparation method, and use. The anti-hair loss composition comprises, by weight, a mixture of 70-99.9% of Platycladus orientalis leaf extract, Ganoderma lucidum extract, and Panax ginseng root extract, and 0.1-30% of Olea europaea leaf extract. The Platycladus orientalis leaf extract, Ganoderma lucidum extract, and Panax ginseng root extract are extracted from Platycladus orientalis leaf, Ganoderma lucidum, and Panax ginseng root, either individually or in combination, with the weight ratio of Platycladus orientalis leaf, Ganoderma lucidum, and Panax ginseng root being 1-9:0.1-3:0.1-3. The present invention synergistically enhances the anti-hair loss efficacy of the composition in terms of antibacterial properties, cell proliferation promotion, and antioxidant properties by combining the Platycladus orientalis leaf extract, Ganoderma lucidum extract, Panax ginseng root extract, and Olea europaea leaf extract.

The invention relates to an exosome composition for treating insomnia and a preparation method thereof. In one aspect, the present invention relates to the use of a combination of a ginseng exosome and a stem cell exosome in the preparation of a medicament for the treatment or prevention of insomnia. The ginseng exosome is prepared by a method comprising the following steps: taking fresh ginseng roots, adding a PBS (Phosphate Buffer Solution) for homogenizing, and filtering to obtain a ginseng solution; extracting the ginseng solution by using a differential centrifugation method to prepare an exosome suspension; the invention also relates to an exosome composition prepared by mixing the ginseng exosome and the stem cell exosome. The invention further relates to a preparation method of the exosome composition. The exosome can be used for treating or preventing insomnia.

The application provides a method for simultaneously enriching rare ginsenosides by co-fermentation of Eurotium cristatum and Panax ginseng and a fermentation product, wherein the Eurotium cristatum is inoculated into a fermentation substrate containing the root of Panax ginseng, and solid fermentation is carried out; the fermentation product contains ginsenosides Rg2, Rg3 and Rh2; the contents of the three rare ginsenosides Rg2, Rg3 and Rh2 in the fermented Panax ginseng raw material are simultaneously improved; the content of Rg2 ginsenoside is increased to about 1.7 times of the original content; the content of Rg3 ginsenoside is increased to about 1.7 times of the original content; and a new ginsenoside Rh2 is obtained, so that the nutritional value and medicinal efficacy of Panax ginseng are increased.

The invention relates to the technical field of fermentation engineering, and particularly discloses a preparation method and application of a ginseng leavening for improving the content of transformed ginsenoside CK. The preparation method comprises the following fermentation conditions: 1) performing carbon source and nitrogen source combined regulation on ginseng root hair fermentation liquor; (2) inoculating the three probiotics into the ginseng root hair fermentation liquor in stages, and carrying out synergistic fermentation; 3) regulating and controlling the dissolved oxygen level in stages; 4) regulating and controlling fermentation conditions by stages; the carbon source comprises fructo-oligosaccharide, inulin and xylooligosaccharide; the nitrogen source comprises soybean protein isolate and pea protein; the probiotics comprise strains of the genus Lactobacillus, the genus Bifidobacterium and the genus Saccharomyces. According to the method, the yield of ginsenoside CK in the ginseng leavening can be remarkably increased, the fermentation efficiency is improved, and the fermentation period is shortened.

This invention discloses a herbal plant extract firming, anti-wrinkle, and lifting freeze-dried powder and its production process, belonging to the field of cosmetic technology. Mannitol, trehalose, and water are added to an emulsifying pot and stirred until dissolved. Then, the following are added sequentially to the emulsifying pot: Lactobacillus / ginseng root fermentation product filtrate, soluble collagen, gentian root extract, tremella polysaccharide, hydrolyzed collagen, carnosine, Ganoderma lucidum extract, saffron flower extract, dragon's blood extract, centella asiatica extract, sodium hyaluronate, dipeptide diaminobutyryl benzylamide diacetate, acetyl hexapeptide-8, Stephania tetrandra extract, arginine / lysine polypeptide, and water. The mixture is stirred and cooled, then discharged, packaged, and placed in a freeze dryer. After cooling, a vacuum is drawn, and the mixture is then heated sequentially. The vacuum is released and cooled to room temperature. The powder is then removed, capped, inspected, and stored. This invention freeze-dries various herbal extracts, producing a freeze-dried powder that firms the skin, has good anti-wrinkle effects, provides rich nutrients to the skin, exhibits excellent stability, and is highly safe to use.

The present invention belongs to the technical field of detection of Fusarium oxysporum causing ginseng root rot, and specifically discloses a specific primer and its application for real-time fluorescence quantitative detection of Fusarium oxysporum causing ginseng root rot in soil, including PCR specific primers and qPCR specific primers; among them, the PCR specific primers include: 12269-F: GACAGAGTTAGGACGACCTTGGACC; 12269-R: CCCTTGGCTCAGTCTTCCCACGGTC; the qPCR specific primers include: upstream primer P-F2: TGACGGGTTTGGTGATTC; downstream primer P-R2: CCAGGCATACTGTCATAGG. The specific primers designed by the present invention can rapidly and quantitatively detect Fusarium oxysporum causing ginseng root rot in soil, establish a standard equation based on the results of real-time quantitative PCR detection, and clarify the relationship between the amount of bacteria in the soil and the occurrence of root rot; it not only provides safe and reliable technical support for the early prevention, diagnosis, and monitoring of ginseng root rot, but also can ensure the safety of ginseng production, reduce economic losses, and promote the high-quality and sustainable development of the ginseng industry.

The present invention relates to the technical field of drug extraction, and particularly to a method for extracting ginseng essential oil by combining eutectic solvent-supercritical technology with column chromatography. The method comprises the following steps: (1) pulverize ginseng root whiskers and add them to a supercritical extraction kettle, and carry out supercritical extraction under the combined action of liquid CO2 and an entrainer, so as to obtain an extract; the entrainer includes absolute ethanol and a eutectic solvent; (2) concentrate the extract until there is no ethanol, dilute it with water, adsorb it on macroporous resin for column chromatography, and successively carry out water washing, elution with 2%-5% ethanol, and elution with 10%-20% ethanol, collect the 10%-20% ethanol eluate, and obtain the product after drying. The present invention has the advantages of high yield, high content of panaxynol, short extraction period, and no environmental pollution.

The invention relates to the technical field of biology, and discloses an anti-cancer composition and a preparation method thereof.The preparation method comprises the following steps that intracellular enzyme of ginseng seedlings is extracted, and a ginseng seedling extracting solution is obtained; mixing the ginseng root total saponins with the ginseng seedling extracting solution, preserving heat and stirring; concentrating and drying to obtain a crude product after heat-preservation stirring is finished; and purifying, concentrating and drying the crude product to obtain the anti-cancer composition. The anti-cancer composition prepared by the preparation method of the anti-cancer composition is based on the anti-cancer function of ginseng and is obtained by converting active components of ginseng in combination with an enzyme system generated in ginseng seedlings, and the anti-cancer composition has toxicity to cancer cells and has protection and repair effects on normal cells.

The present invention relates to the field of cosmetics technology, specifically to a repairing composition for lowering the freezing point of essential oils and a preparation method thereof. The composition comprises slowly dripping phytosterol / octyldodecanol lauroyl glutamate into jojoba seed oil stirred at 200 rpm. The stirring speed is then reduced, sorbitan oleate is added, and the mixture is stirred until uniform. A ginseng root extract extracted with supercritical CO2 is then added to produce the repairing composition. In the present invention, the phytosterol / octyldodecanol lauroyl glutamate is slowly dripped into the stirred jojoba seed oil to form fine microspheres. The sorbitan oleate's opening-like structure then separates the microspheres, reducing the interaction between them and lowering the freezing point of wax and ester components in the oil. The ginseng root is then extracted with supercritical CO2 to extract more volatile oils and lower the freezing point of the ginseng root extract. The repairing composition not only has a lower freezing point but also simultaneously helps lower the freezing point of the essential oil to which it is added.

This invention discloses a gene derived from ginseng. PgLBD45 The gene was overexpressed and its application in increasing ginsenoside content was studied. Overexpression of this gene can effectively regulate the ginsenoside content in ginseng roots. This invention detected nine monomeric saponins, and the results showed that five of the obtained saponins... PgLBD45 The contents of Rh1 and Rb2 in overexpressing positive hairy roots were significantly decreased, while the content of Rb1 was significantly increased. These results indicate that... PgLBD45 Genes are involved in regulating the synthesis of ginsenosides. This invention utilizes overexpression... PgLBD45 Genes can significantly regulate the content of multiple ginsenosides, which is of great research value for studying ginsenoside content and provides a powerful technical means for developing ginseng germplasm resources with high ginsenoside content.

The invention provides Rhodococcus qingsheng and application thereof in relieving continuous cropping obstacles of crops, and belongs to the technical field of microorganisms. The Rhodococcus qingsheng JA11 is separated and screened from the nature for the first time, phenolic acid autotoxic substances generated by ginseng continuous cropping obstacles can be efficiently degraded, the degradation rate of benzoic acid can reach 91.51%, various phenolic acids such as vanillic acid and cinnamic acid can be effectively degraded, and the degradation spectrum is wide; when the Rhodococcus qingsheng JA11 is applied under field conditions, the content of benzoic acid in soil for continuous cropping of ginseng can be effectively reduced, meanwhile, the root diseases of ginseng can be controlled to a certain extent, the growth indexes such as the survival rate and the root length of ginseng are remarkably improved, and a certain yield increasing effect is achieved.

This invention discloses an anhydrous soothing and repairing spray based on small molecule transdermal technology and its preparation method, relating to the field of skincare sprays. The invention constructs a bioactive system centered on yeast fermentation product filtrate, lactobacillus fermentation product, and lactobacillus / ginseng root fermentation product filtrate, and synergizes with small molecule polyols to form a transdermal delivery network. This achieves efficient and stable dispersion and deep delivery of multiple active ingredients under anhydrous conditions, significantly reducing the system's water activity and improving the overall stability and activity retention rate of the product. By introducing functional ingredients such as acetyl hexapeptide-8, sodium hyaluronate, niacinamide, 3-o-ethyl ascorbic acid, and tranexamic acid, a synergistic effect of soothing repair, anti-inflammatory calming, antioxidant, and anti-wrinkle firming is achieved.

The invention relates to the technical field of cosmetics, in particular to a ginseng extract for preparing hydropathic compress water, a preparation method of the ginseng extract and the hydropathic compress water. The preparation method of the ginseng extract for preparing the wet compress water comprises the following steps: drying and crushing ginseng root hairs to prepare ginseng powder; mixing the ginseng powder with a solvent to obtain a mixture; the solvent is an aqueous solution of 1, 3-propylene glycol; carrying out micro-jet homogenization treatment on the mixture to prepare a homogenized liquid; centrifuging the homogenized liquid, and collecting the liquid obtained by centrifuging to obtain the ginseng extract for preparing the wet compress water.

The invention discloses skin anti-aging brightening essence which comprises the following raw materials in parts by weight: 10-15 parts of an extraction complexing agent, 8-12 parts of modified shell powder, 3-5 parts of active peptide, 4-7 parts of sodium hyaluronate, 8-12 parts of glycerinum and 15-20 parts of deionized water. According to the essence disclosed by the invention, the extraction complexing agent and the modified shell powder are adopted as matrix materials, the active peptide, the sodium hyaluronate and the glycerol are added as blending materials, and the skin anti-aging, brightening and moisturizing effects of the product are optimized through blending and coordination of the raw materials; ginkgo leaves, aesculus chinensis leaves and ginseng roots are adopted as extraction matrix agents of an extraction complexing agent, and chitosan liquid permeability improvement is performed, so that the extraction efficiency is optimized, and meanwhile, the skin glossiness, the skin transparency, the pore shrinkage rate and the skin absorption rate of the product are remarkably improved.

The invention relates to the field of purification, in particular to a novel method for extracting ginsenoside from three kinds of plants, namely, P. ginseng, P. vietnamensis and P. notoginseng, of the genus P. ginsenseng. The invention also relates to a method for extracting ginsenoside from three kinds of plants, namely P. ginseng, P. vietnamensis and P. notoginseng. The method comprises the following steps: cleaning, drying and grinding dried ginseng roots to prepare ginseng powder; mixing ginseng root powder with an ethanol water solution to serve as a detergent; vacuum concentration: removing most ethanol under a vacuum condition to obtain a high-concentration solution; concentrating the ginseng root extract in the solution I under a vacuum condition; re-dissolving: dissolving the ginseng root extract in distilled water to obtain a solution II; centrifuging: separating the solution II in a centrifugal machine; filtering is performed; freezing the obtained sterile extract on a tray; and then performing vacuum drying. The method has the advantages that the extraction rate of ginsenoside is improved while the cost is controlled, and the ginseng extract can be applied to cosmetics, pharmacy and food industries.

The invention relates to the technical field of cosmetics, in particular to a facial cleanser containing a ginseng extract and a preparation method of the facial cleanser. The facial cleanser containing the ginseng extract is prepared from the following components in percentage by weight: 0.01 to 0.5 percent of hydrolyzed ginsenoside, 0.01 to 8 percent of lactobacillus / ginseng root fermentation product filtrate, 0.01 to 3.0 percent of beta-glucan and derivatives thereof, 0.1 to 1 percent of dipotassium glycyrrhizinate, 0.001 to 1 percent of citrus peel extract, 8 to 27 percent of first surfactant, 0.1 to 3 percent of second surfactant and the balance of cosmetically acceptable auxiliary materials. Through the synergistic effect of the rare ginsenoside and the lactobacillus / ginseng root fermentation product filtrate, the same cleaning power can be maintained and the degreasing amount can be obviously reduced under the condition of obviously reducing the surfactant dosage, the coexistence of instantaneous tightening and long-acting relieving is realized, the pain point of face cleaning and draining of saponin is solved, and the effects of cleaning, relieving, moisturizing, resisting inflammation and the like are achieved.