Adrenergic receptor SNP for improved milking characteristics
A technology of adrenaline and receptors, which is applied in the determination/testing of microorganisms, organic chemistry, fermentation, etc., and can solve problems such as the inability to predict the characteristics of lactation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0027] Example 1. Evaluation of mRNA levels in white blood cells of cows with fast and slow lactation rates.
[0028] Eight animals were selected according to the duration of their lactation and divided into fast and slow groups. For initial assays, slow lactating animals were numbered 90, 264, 279 and 321. Fast lactating animals were numbered 272, 273, 281 and 289. Their blood (approximately 15 mL) was collected in EDTA-filled Vacutainers (BD, Franklin Lakes, NJ). The known sequences of NCBI and the "Oligo" program were used to design primer sets specific for GAPDH, α2-, β1-, β2-adrenergic receptors and β-arrestin.
[0029] RNA was isolated from blood samples using the RNeasy RNA isolation method (Qiagen, Valencia, CA). Mix 1 volume of whole blood with 5 volumes of erythrocyte lysis buffer. This mixture was incubated on ice and mixed by brief vortexing twice during incubation. The mixture was then centrifuged at 400 g for 10 minutes at 4°C. Discard the supernatant and s...
Embodiment 2
[0035] Example 2. Relationship between A11C genotype and dairy cow SCS and / or lactation speed
[0036] Bovine DNA was obtained from the Cooperative Dairy DNA Repository (CDDR) group (GeneEvaluation and Mapping Laboratory, Bldg. 200Rm 2A, ARS-USDA, BARC-EastBeltsville, MD 20705). SCS phenotypes were obtained for all CDDR animals. Lactation velocity (MS) data are also available for a subset of CDDR animals. CDDR animals with MS data were first genotyped by A11C assay, while the remaining CDDR animals were divided into subgroups of "high" and "low" somatic cell score (SCS) phenotype categories. DNA samples were obtained and assayed. Data sets were assigned and analyzed in duplicate. Analysis revealed a relationship between A11C and SCS.
[0037] 663 animals from CDDR were genotyped at the A11C locus with one of the following primer pairs:
[0038] TGGAACTGGCTGAACTGACA (SEQ ID NO 1)
[0039] AGTTGATGGCTTCCTTGTGG (SEQ ID NO 2)
[0040] AGGTCCGCTCGCTGAGG (SEQ ID NO 3)
[004...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com