Expression of recombinant human metaphase factor (rh-Midkine), preparation and application of monoclone antibody

A monoclonal antibody, midkine technology, applied in the field of biomedicine, can solve the problems of low specificity, detection limit, cross-reactivity and so on

Inactive Publication Date: 2008-10-29
NANJING UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006]Because there is still a lack of specific MK monoclonal antibody detection and MK monoclonal antibody drugs for targeted treatment of tumors, the clinical immunological detection of MK is With polyclonal antibodies, there are inevitable shortcomings such as cross-reaction and low specificity in the detection process
It is precisely because there is no highly specific human MK monoclonal antibody that the detection of MK, especially the detection of MK in blood and urine, has been considerably limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression of recombinant human metaphase factor (rh-Midkine), preparation and application of monoclone antibody
  • Expression of recombinant human metaphase factor (rh-Midkine), preparation and application of monoclone antibody
  • Expression of recombinant human metaphase factor (rh-Midkine), preparation and application of monoclone antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Preparation of recombinant MK protein antigen and verification of activity

[0035] 1. Primer design

[0036] According to the pelB signal peptide sequence, two primers were designed, and NdeI and NcoI restriction sites were introduced at both ends of the primers, respectively, for the transformation of pET30a-MK strain plasmid.

[0037] pelB-5 primer:

[0038] 5'tatgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggccc 3'

[0039] pelB-3 primer:

[0040] 5'catgggccatcgccggctgggcagcgaggagcagcagaccagcagcagcggtcggcagcaggtatttca 3'

[0041] pelB signal peptide sequence

[0042] catatg aaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgccccagccggccgatggcc ccatgg

[0043] 2. Transformation of pET30a-MK vector

[0044] The preserved pET30a-MK plasmid and pel signal peptide sequence were digested with NdeI and NcoI at 37°C for 3 hours, followed by 1% gel electrophoresis for 30 minutes, and the gel recovery kit (BioFlux Company) was used to gel the ta...

Embodiment 2

[0052] Example 2: Preparation of anti-MK monoclonal antibody, identification of subclasses

[0053] 1. Immunized animals

[0054] Take 20 μg of purified and freeze-dried 30P-MK recombinant protein, dissolve it in 100 μl of sterile PBS buffer, add 100 μl of Freund’s complete adjuvant and mix well, and perform subcutaneous routine immunization on 6-week-old female Balb / c mice After 3 weeks, get 20 micrograms of MK recombinant protein and dissolve it with 100 microliters of sterile PBS, add 100 microliters of Freund's incomplete adjuvant to mix, and inject intraperitoneally; 7 days later, use indirect ELISA (100 nanograms of 30P-MK protein package The titer was tested, and the titer was 1 / 10240. After 30 days, 20 micrograms per MK protein was dissolved in 100 microliters of sterile PBS, and the tail vein was injected for booster immunization.

[0055] 2. Screening and cloning of cell fusion and positive wells

[0056] After 3 days of booster immunization, the splenocytes of the...

Embodiment 3

[0061] Example 3: MK detection in human gastric cancer tissue

[0062] 1. Western blotting: ① Take normal gastric tissue (lane 1), cancer tissue from patients with gastric cancer (lane 2) and corresponding paracancerous tissue (lane 3) and grind with corresponding volume of PBS, then take 100ug of total protein and run for 15 % SDS-PAGE protein gel electrophoresis; ②, 100V, 2h, transfer to nitrocellulose membrane; 5% skimmed milk powder, room temperature blocking 2h; ③, with 9E10 (1:1000) monoclonal antibody incubation for two hours; TBST wash 4 4 times (10 minutes / time); ④, add goat anti-mouse IgG-HRP (Boster, 1 / 1000 dilution), incubate at room temperature for 1.5 hours; wash 4 times with TBST (10 minutes / time). ⑤. EZ-ECL kit (Biological Industries) was used to verify the specificity of 9E10 monoclonal antibody.

[0063] 2. Immunohistochemistry: ①. The glass slides were treated with 2% hydrochloric acid alcohol and coated with poly-lysine; 37 cases of gastric cancer tissues ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to view more

Abstract

The invention belongs to the field of bio-medicine and discloses the expression of recombinant human midkine (rh-Midkine) and the preparation and the application of the monoclonal antibody thereof. The invention is characterized in that the prokaryotic expression of midkine (Midkine, MK) is achieved by Escherichia coli, and the obtained recombinant protein 30P-MK has a bioactivity for promoting cell proliferation so as to provide foundation for the research of MK in the fields of tumor, cell biology, nervous system, etc. Anti-human MK monoclonal antibody hybridoma can be prepared by immunizing Balb/c mouse by 30P-MK protein after purifying the 30P-MK protein, fusing spleen cells and SP2/0 cells and sieving, and the hybridoma can secrete IgG1 monoclonal antibody. It is verified by Western-blotting of midkine in human tumor tissue sample and immune histochemistry that the monoclonal antibody has high specificity and low background and can be used for diagnosis kit for clinically and experimentally determining the expression level of MK in tumor tissue and blood serum, thus establishing the foundation for target therapy of tumor by using MK monoclonal antibody.

Description

technical field [0001] The invention belongs to the field of biomedicine, and relates to the prokaryotic expression of human midkine MK, the preparation and application of monoclonal antibody. Background technique [0002] In 1988, Japanese scholar Kadomatsu found Midkine (MK) gene in the cDNA library of mouse embryonic tumor cell line HM1 induced by retinoic acid, which is called midkine in Chinese. Early studies have found that midkine is a cytokine that plays an important role in cell growth and differentiation. It can promote the growth and differentiation of normal cells, especially the development of nerve cells. In recent years, studies on human tumors have found that MK has biological functions closely related to the occurrence and development of tumors, such as inducing cell transformation, promoting mitosis, angiogenesis, anti-apoptosis, and enhancing fibrinolysis. unusual expression. [0003] Konishi et al performed immunohistochemical analysis on 15 cases of l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/63C12N15/12C12N1/21C12P21/02C07K19/00C07K16/18C12N5/18A61K39/395G01N33/577G01N33/574G01N33/49G01N33/493A61P35/00
Inventor 侯亚义赵树立王庆苓黄亚红王会谢浩
Owner NANJING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap