Unlock instant, AI-driven research and patent intelligence for your innovation.

Small interfering RNA used for curing psoriasis

A psoriasis and small interference technology, applied in the direction of DNA / RNA fragments, gene therapy, recombinant DNA technology, etc., can solve the problem of unclear genes, no radical medicine or treatment technology process, unclear pathogenesis of psoriasis, etc. problem, to achieve the effect of reducing the generation

Inactive Publication Date: 2011-05-25
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The pathogenesis of psoriasis is still unclear so far, the genes involved are even less clear, and there is no radical drug or treatment technology process for treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small interfering RNA used for curing psoriasis
  • Small interfering RNA used for curing psoriasis
  • Small interfering RNA used for curing psoriasis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Triple distilled water (d 3 h 2 O), add 0.2 milliliters of DEPC to every 100 milliliters of triple distilled water, incubate at room temperature for 5 hours, then prepare DEPC water by autoclaving at 121.4 DEG C for 15 minutes. Dissolve the small interfering RNA with DEPC water so that the final concentration of the small interfering RNA is 10nM, which is the small interfering RNA liquid, which is divided into 0.5ml small packages and stored at minus 60°C for future use. The rubbing method and treatment process are as follows.

[0032] Wipe 0.5ml small interfering RNA liquid every time per 500 square centimeters every day. Soak the psoriasis lesions with hot water or wet hot towels first, soak the skin softly, remove dandruff and keratinized dead skin. Take the frozen small interfering RNA liquid, and naturally melt it into a liquid at room temperature (15-25° C.), and then apply the small interfering RNA liquid to the skin lesions.

[0033] Volunteer Xu, male, 53 y...

Embodiment 2

[0035] The preparation, wiping method and treatment process of the small interfering RNA liquid are as in Example 1.

[0036] Volunteer Liu, male, 39 years old. Treat 1 skin lesion on the left arm, once a day, 0.5 ml. After 45 days of medication, the area of ​​skin lesions disappeared by about 50%.

[0037] Untitled.ST25.txt

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the biological technical field and particularly relates to a short and double-stranded RNA used for curing psoriasis, namely a small interfering RNA (siRNA). The siRNA has the following sequences: the target sequence is 5'-3'aaagctgaagaggaaaccacc; the sense strand is 5'-3'agcugaagaggaaaccaccTT; and the anti-sense strand is 3'-5'Ttucgacuucuccuuuggugg. The siRNA of the invention is used for curing psoriasis, thus the target protein can be effectively reduced, the progression of psoriasis can be blocked and the treatment effect is remarkable.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a short, double-stranded ribonucleic acid, namely small interfering RNA (siRNA), for treating psoriasis. Background technique [0002] Psoriasis, commonly known as psoriasis, is a chronic autoimmune skin disease characterized by severe scaly erythema, which cannot be completely cured at present, and the exact cause of psoriasis has not yet been clarified. In addition, existing treatments also have certain limitations, such as inconvenience, limited efficacy, toxicity, and high cost. [0003] According to the 2006 study "Psoriasis and Psoriatic Arthritis: Strategic Analysis of the Market" by Kalorama Information in the United States, the number of patients with psoriasis and psoriatic arthritis in the United States is about 7.8 million; it is estimated that in 2016 The number of people with psoriasis and psoriatic arthritis in the United States will reach 8.5 million. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11A61K48/00A61P17/06
Inventor 郭骁才
Owner CHENGDU INST OF BIOLOGY CHINESE ACAD OF S