Anti-tumor targeting engineering bacteria and bacterial agent and method for preparing bacterial agent
An engineering bacteria, anti-tumor technology, applied in anti-tumor drugs, biochemical equipment and methods, microorganism-based methods, etc., can solve problems such as normal tissue toxicity, and achieve the effect of short fermentation period and simple growth conditions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1: Example of the construction method of the anti-tumor targeting engineered bacteria of the present invention
[0055] PCR amplified P lac 启动子LacI末端与LacZ前端序列GCGCCCAATACGCAAA CCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATT;设计引物,Plac-F: CACCCTCATCAGTGCCAACATAGTAA GCCAGTATACACTCCGCTAGCGCG CGCCCAATACGCAAACCGCCT , the underlined part is the specific primer, and its front sequence is the homology arm; Plac-R: ATTTCTAGAGGATCC CCGGGTACCGAGCTCGAATTCGTA ATCATGGTCATAGCTGTTTC , the underlined part is the specific primer, its front sequence is the homology arm, the pBlueScript KS(+) plasmid is used as the template, and Plac-F / Plac-R is used as the primer to amplify the 311bp truncated P lac For the promoter and homology arm part, the reaction conditions are: pre-denaturation at 94°C for 4 min; denaturation at...
Embodiment 2
[0065] Example 2: Example of the preparation method of the anti-tumor targeting engineered bacterial agent of the present invention
[0066] Process reference Figure 8 :
[0067] (1) Activation of bacteria
[0068] Streak-inoculate the preserved recombinant Escherichia coli LMA1 on the slant of the solid seed medium, and culture it upside down at 37°C for 12 hours; pick a single colony and streak it, and culture it upside down at 37°C for 12 hours for further purification;
[0069] (2) Preparation of fermented seed liquid
[0070] Pick Escherichia coli LMA1 to inoculate into 10ml containing 12.5μg.mL -1 Chloramphenicol in LB medium, 200r.min at 37°C -1 Shake culture for 8h to mid-logarithmic growth, inoculate 10mL of culture solution into 1000mL containing 12.5μg.mL -1 Chloramphenicol LB medium, 200r.min at 37°C -1 Shake culture for 13 hours to obtain the fermentation liquid of the primary seed tank; sterilize the secondary seed tank at 121°C for 30 minutes, put it into...
experiment example 1
[0086] Experimental Example 1: Inhibitory Effect of Gene Recombinant Escherichia coli LMA1 Bacterial Agent on the Growth of B16F10 Mice Melanoma
[0087] The purpose of this experiment is to study the inhibitory effect of Escherichia coli LMA1 bacterial agent on the growth of melanoma in B16F10 mice
[0088] Mouse melanoma B16-F10 cells similar to human melanoma were routinely cultured in 1640 medium with 10% FCS in 5% CO 2 cultured at 37°C in a cell culture incubator. The cells in the exponential proliferation phase were digested with 0.25% trypsin, collected by centrifugation, washed 3 times with PBS, stained with trypan blue, and the cell suspension was counted, and the cell viability was detected to be over 95%, and finally resuspended to 1×10 cells in PBS. 6 / mL. Forty C57BL / 6 female mice of 6-8 weeks were selected, and 100ul of B16F10 mouse melanoma cells were subcutaneously injected on the right side of the back of the mice. After 6 days, the mice were randomly divid...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com