Swine halothane gene rapid typing kit and detection method thereof
A porcine halothane and kit technology, which is applied in the porcine halothane gene rapid typing kit and its detection field, can solve the problems of long time-consuming, cumbersome steps, and low throughput, so as to reduce false positive results and avoid external source pollution , the effect of simple operation steps
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Porcine halothane gene rapid typing kit, its reagents include primer master mix, HRM PCR master mix and Nuclease-free dH 2 O.
[0031] Among them, the primer premix: the concentration of the two primers in the mixture is 10 μM, and the primer sequences are as follows:
[0032] Upstream primer: GTTCCCTGTGTGTGTGCAATGGT;
[0033] Downstream primer: GCCAGGGAGCAAGTTCTCAGTAATG;
[0034] HRM PCR master mix: the composition and volume ratio are as follows:
[0035] HotStar Taq DNA Polymerase (5U / μl): 10×PCR Buffer (Mg 2+ Plus): dNTPMixture (2.5 mM each): EvaGreen dye (1.2 μM)=1:1:2:6.
Embodiment 2
[0037] The steps for rapid genotyping of porcine halothane gene using the above kit are as follows:
[0038] Step 1: Mix Primer Master Mix, HRM PCR Master Mix, Nuclease-free dH 2 O and DNA samples extracted in advance (need to be extracted by themselves, this kit does not provide extraction reagents and methods) are taken out from the -20°C refrigerator and melted on ice;
[0039] Step 2: Prepare the reaction premix according to Table 1. The volume of the premix solution depends on the number of samples to be tested, but considering the unavoidable loss during the preparation and packaging process, it is recommended to configure 10% more reaction premix solution on the basis of the theoretical volume;
[0040]Table 1 reaction system
[0041]
[0042] Step 3: Mix the reaction master mix evenly, and dispense into PCR tubes according to the required volume;
[0043] Step 4: Add the sample DNA template to the PCR of the aliquoted reaction master mix, and mix gently;
[0044...
Embodiment 3
[0054] Use this kit to perform halothane genotyping detection on 20 pig DNA samples with a concentration of 10ng / μl:
[0055] Step 1: Take the primer master mix, HRM PCR master mix, Nuclease-free dH2O and pre-extracted DNA samples out of the -20°C refrigerator and thaw on ice;
[0056] Step 2: Prepare the reaction premix according to Table 4. Configure 10% more reaction premix on the basis of theoretical volume;
[0057] Table 4 reaction system
[0058]
[0059] Step 3: Mix the reaction master mix evenly, and distribute it into 20 PCR tubes according to the required volume, 9 μl per tube;
[0060] Step 4: Add the sample DNA template to the PCR tube containing the reaction master mix, add 1 μl to each sample, and mix gently;
[0061] Step 5: According to the optimization program listed in Table 5, adjust the working program of the fluorescence quantitation instrument.
[0062] Table 5 Program optimized for Rotor-Gene Q
[0063]
[0064] Step 6: Put the prepared PCR t...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com