Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Swine halothane gene rapid typing kit and detection method thereof

A porcine halothane and kit technology, which is applied in the porcine halothane gene rapid typing kit and its detection field, can solve the problems of long time-consuming, cumbersome steps, and low throughput, so as to reduce false positive results and avoid external source pollution , the effect of simple operation steps

Inactive Publication Date: 2013-12-04
SICHUAN AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The PCR-RFLP method has been difficult to apply to large-scale halothane gene screening due to the cumbersome steps and the need for gel electrophoresis detection after the enzyme digestion reaction, making it time-consuming, low-throughput, and subject to subjective factors.
For the detection of a single sample, the traditional PCR-RFLP method takes 14 to 16 hours. If a large number of samples are scanned and typed, the workload and time-consuming are unimaginable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Swine halothane gene rapid typing kit and detection method thereof
  • Swine halothane gene rapid typing kit and detection method thereof
  • Swine halothane gene rapid typing kit and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Porcine halothane gene rapid typing kit, its reagents include primer master mix, HRM PCR master mix and Nuclease-free dH 2 O.

[0031] Among them, the primer premix: the concentration of the two primers in the mixture is 10 μM, and the primer sequences are as follows:

[0032] Upstream primer: GTTCCCTGTGTGTGTGCAATGGT;

[0033] Downstream primer: GCCAGGGAGCAAGTTCTCAGTAATG;

[0034] HRM PCR master mix: the composition and volume ratio are as follows:

[0035] HotStar Taq DNA Polymerase (5U / μl): 10×PCR Buffer (Mg 2+ Plus): dNTPMixture (2.5 mM each): EvaGreen dye (1.2 μM)=1:1:2:6.

Embodiment 2

[0037] The steps for rapid genotyping of porcine halothane gene using the above kit are as follows:

[0038] Step 1: Mix Primer Master Mix, HRM PCR Master Mix, Nuclease-free dH 2 O and DNA samples extracted in advance (need to be extracted by themselves, this kit does not provide extraction reagents and methods) are taken out from the -20°C refrigerator and melted on ice;

[0039] Step 2: Prepare the reaction premix according to Table 1. The volume of the premix solution depends on the number of samples to be tested, but considering the unavoidable loss during the preparation and packaging process, it is recommended to configure 10% more reaction premix solution on the basis of the theoretical volume;

[0040]Table 1 reaction system

[0041]

[0042] Step 3: Mix the reaction master mix evenly, and dispense into PCR tubes according to the required volume;

[0043] Step 4: Add the sample DNA template to the PCR of the aliquoted reaction master mix, and mix gently;

[0044...

Embodiment 3

[0054] Use this kit to perform halothane genotyping detection on 20 pig DNA samples with a concentration of 10ng / μl:

[0055] Step 1: Take the primer master mix, HRM PCR master mix, Nuclease-free dH2O and pre-extracted DNA samples out of the -20°C refrigerator and thaw on ice;

[0056] Step 2: Prepare the reaction premix according to Table 4. Configure 10% more reaction premix on the basis of theoretical volume;

[0057] Table 4 reaction system

[0058]

[0059] Step 3: Mix the reaction master mix evenly, and distribute it into 20 PCR tubes according to the required volume, 9 μl per tube;

[0060] Step 4: Add the sample DNA template to the PCR tube containing the reaction master mix, add 1 μl to each sample, and mix gently;

[0061] Step 5: According to the optimization program listed in Table 5, adjust the working program of the fluorescence quantitation instrument.

[0062] Table 5 Program optimized for Rotor-Gene Q

[0063]

[0064] Step 6: Put the prepared PCR t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a swine halothane gene rapid typing kit, wherein reagents of the kit comprise primer premix, HRM PCR (High Resolution Melt Polymerase Chain Reaction) premix and Nuclease-free dH2O. The invention also provides a swine halothane gene rapid typing detection method. The method provided by the invention has high flux; gene typing detection can be simultaneously performed on 96 or 384 samples at one time; and the swine halothane gene rapid typing kit and the detection method therefore are suitable for large-scale screening of swine halothane genes and are particularly suitable for large-scale commercial pig farms.

Description

technical field [0001] The invention relates to a porcine halothane gene rapid typing kit and a detection method thereof, belonging to the field of biotechnology. Background technique [0002] Halothane gene (Hal), also known as ryanodine receptor gene (RYR1) or calcium ion release channel gene, is the main gene that causes porcine stress syndrome (Porcine stress syndrome, PSS). The gene is located on pig chromosome 6p11-q21, which is derived from C in RYR1 1843 mutation to T 1843 , so that the 615th arginine of the receptor protein becomes cysteine, causing structural and functional changes. When the stress factor acts, a large amount of Ca2+ is released abnormally, causing continuous muscle contraction, resulting in PSS, which is manifested as shortness of breath, rapid heartbeat, muscle stiffness, spastic contraction of hind limbs, and even death. PSE (Pale, soft, exudative) meat or DFD (Dark, firm, dry) meat, causing huge economic losses to the pig industry. Accordin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 马继登李明洲李学伟
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com