Anti-insect protein Cry1A.401 and expression vector and application thereof

An insect-resistant protein and carrier technology, applied in the fields of genetic engineering and biological control, can solve the problems of lack of insect-resistant varieties, environmental pollution, ecological imbalance, etc., and achieve the effects of expanding the insect-resistant spectrum, reducing environmental pollution, and reducing the amount of use.

Active Publication Date: 2013-07-31
INST OF CROP SCI CHINESE ACAD OF AGRI SCI +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the lack of suitable insect-resistant varieties, the current main method to solve insect pests is to spray chemical insecticides during the growth process; however, chemical insecticides kill pests and their natural enemies at the same time, causing ecological imbalance and environmental pollution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-insect protein Cry1A.401 and expression vector and application thereof
  • Anti-insect protein Cry1A.401 and expression vector and application thereof
  • Anti-insect protein Cry1A.401 and expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Synthesis of Cry1A.401 gene

[0033] Through codon optimization, Cry1Ab, Cry1F and Cry1Ac were synthesized (the synthesis work was completed by Sangon Bioengineering (Shanghai) Co., Ltd.), and then by the SOE method (1992, Cai Yuyang), the first and second functional domains of Cry1Ab, The third functional domain of Cry1F and the fragment of Cry1Ac (1837bp to 3531bp) are spliced ​​together to form a new Cry1A.401 DNA sequence, the nucleotide sequence of which is shown in SEQ ID NO.1. It is generally believed that: Bt protein is composed of three structural domains, domain I includes 250-300 amino acids at the N-terminal of the active insecticidal protein, and consists of 7 α-helices, one of which is relatively hydrophobic and located in the structural domain The center of I is surrounded by the other 6 α-helices. It has been proven that it is related to the toxicity of insecticidal proteins. The hydrophobic α-helix has the ability to insert into the midgut ce...

Embodiment 2

[0034] Example 2 Expression of Cry1A.401 gene in prokaryotic system and detection of product toxicity

[0035] In order to detect the in vitro expression of the modified Cry1A.401 gene and its toxicity to the corn borer, we constructed a Bt prokaryotic expression vector. According to the needs of cloning the Bt gene, the NdeI endonuclease recognition site sequence AAGGAGATATACATA was added to the 5' end of the primer sequence, and the XhoI endonuclease recognition site sequence GGTGGTGGTGCTCGAG was added to the 3' end. The designed primer sequences are listed as: F: AAGGAGATATACATA TGGACAACAACCCGAAC; R: GGTGGTGGTGCTCGAG TTCTC CATAAGGAGTAA. Using the spliced ​​DNA as a template, the Cry1A.401 gene was amplified with the adapter-added primers, and the Cry1A.401 gene fragment was recovered and purified by the gel extraction kit. Digest pET30a with restriction endonucleases NdeI and XhoI, recover and purify. The two fragments were ligated, and the resulting prokaryotic expre...

Embodiment 3

[0048] Example 3 Expression of Cry1A.401 Gene in Transgenic Plants and Toxicity Detection of Expression Products

[0049] Add the SmaI endonuclease recognition site sequence CTCTAGAGGATCCCC and TCGAGCTCGGTACCC at the 5' and 3' ends of the primer sequence respectively, and design the primer as: F: 5' CTCTAGAGGATCCCC ATGGACAACAACCCGAAC3';R:5' TCGAGCTCGGTACCC CTACTCGAGTGTGGCAGTAAC 3', using the synthesized Cry1A.401 nucleotide sequence as a template, amplified with primers with adapters, and recovered the target fragment with a gel recovery purification kit. At the same time, the plant expression vector CPB was digested with SmaI, and the CPB fragment after digestion was recovered and purified. The two fragments were ligated (In-Fusion HD cloning kit, Clontech), and the eukaryotic expression plasmid CPB-Cry1A.401 (full text unified) was constructed (the promoter was CaMV35S, and the marker gene was the herbicide resistance gene Bar of Streptomyces hygroscopicus ). Detection ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an anti-insect protein Cry1A.401, which is characterized by comprising: (1) an amino acid sequence shown as SEQ ID No.2, or (2) an amino acid sequence which is obtained by performing substitution, deletion and / or addition of one or more amino acids on the amino acid sequence shown as SEQ ID No.2 and has equal function. As proved by an in-vitro experiment, a modified and synthesized Bt gene toxoggenic protein has a remarkable insecticidal effect on corn borers. The anti-insect protein Cry1A.401 can be stably and efficiently expressed in monocotyledons, and is further applied to production of anti-insect transgenic plants.

Description

technical field [0001] The invention relates to the fields of genetic engineering and biological control, in particular to an insect-resistant protein Cry1A.401, its expression vector and application. Background technique [0002] The Bt gene encodes an insecticidal crystal protein from Bacillus thuringing Hansis. It produces delta-endotoxin insecticidal parasporal crystal proteins during sporulation, and these proteins have high insecticidal activity. It is generally believed that the insecticidal effect of crystal proteins is divided into five steps: including dissolution, enzymatic activation, binding to receptors, insertion, hole or ion channel formation, and each step can affect the insecticidal effect of crystal proteins (Moonsom et al. , 2007). After the parasporal crystal enters the insect body, the disulfide bond is opened under the alkaline condition of the midgut, dissolved into a protoxin, and then activated into an active toxin protein under the action of tryp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/325C12N15/32C12N15/63C12N15/84C12N1/21C12N5/10A01H5/00A01N47/44A01P7/04
Inventor翁建峰李新海杨小艳李明顺郝转芳张德贵白丽张芳军雷开荣张世煌
OwnerINST OF CROP SCI CHINESE ACAD OF AGRI SCI